\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724425039:

Variant ID: vg0724425039 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24425039
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGATGTATGATTTGCTAGTATAATTCCTGTCACAGTGAAAAATCTCACAGAACATTGCTGAAAGGGGAAAATCCAAATACCCCCCCCCTACAAGTCAC[T/C]
GCTCTTTCTACTCTCCCCCCACAACTCAATATTGTTCAAAACACTACACATAAATTAATTTCTCTTCCAATTTTCCACTCCTATTCAGTTTTTACGCTTT

Reverse complement sequence

AAAGCGTAAAAACTGAATAGGAGTGGAAAATTGGAAGAGAAATTAATTTATGTGTAGTGTTTTGAACAATATTGAGTTGTGGGGGGAGAGTAGAAAGAGC[A/G]
GTGACTTGTAGGGGGGGGGTATTTGGATTTTCCCCTTTCAGCAATGTTCTGTGAGATTTTTCACTGTGACAGGAATTATACTAGCAAATCATACATCCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.20% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 67.40% 32.60% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 39.90% 60.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724425039 T -> C LOC_Os07g40750.1 upstream_gene_variant ; 2707.0bp to feature; MODIFIER silent_mutation Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0724425039 T -> C LOC_Os07g40770.1 downstream_gene_variant ; 4148.0bp to feature; MODIFIER silent_mutation Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0724425039 T -> C LOC_Os07g40760.1 intron_variant ; MODIFIER silent_mutation Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724425039 NA 1.87E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724425039 1.71E-11 3.29E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 1.34E-10 6.38E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 NA 7.08E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 2.37E-07 NA mr1181_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 1.93E-19 2.86E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 8.81E-19 4.63E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 4.98E-08 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 9.94E-08 NA mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 1.59E-07 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724425039 1.89E-08 NA mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251