\
| Variant ID: vg0724425039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24425039 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 81. )
TAGGATGTATGATTTGCTAGTATAATTCCTGTCACAGTGAAAAATCTCACAGAACATTGCTGAAAGGGGAAAATCCAAATACCCCCCCCCTACAAGTCAC[T/C]
GCTCTTTCTACTCTCCCCCCACAACTCAATATTGTTCAAAACACTACACATAAATTAATTTCTCTTCCAATTTTCCACTCCTATTCAGTTTTTACGCTTT
AAAGCGTAAAAACTGAATAGGAGTGGAAAATTGGAAGAGAAATTAATTTATGTGTAGTGTTTTGAACAATATTGAGTTGTGGGGGGAGAGTAGAAAGAGC[A/G]
GTGACTTGTAGGGGGGGGGTATTTGGATTTTCCCCTTTCAGCAATGTTCTGTGAGATTTTTCACTGTGACAGGAATTATACTAGCAAATCATACATCCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 67.40% | 32.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 39.90% | 60.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724425039 | T -> C | LOC_Os07g40750.1 | upstream_gene_variant ; 2707.0bp to feature; MODIFIER | silent_mutation | Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0724425039 | T -> C | LOC_Os07g40770.1 | downstream_gene_variant ; 4148.0bp to feature; MODIFIER | silent_mutation | Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0724425039 | T -> C | LOC_Os07g40760.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.817; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724425039 | NA | 1.87E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724425039 | 1.71E-11 | 3.29E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 1.34E-10 | 6.38E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | NA | 7.08E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 2.37E-07 | NA | mr1181_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 1.93E-19 | 2.86E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 8.81E-19 | 4.63E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 4.98E-08 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 9.94E-08 | NA | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 1.59E-07 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724425039 | 1.89E-08 | NA | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |