\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724417110:

Variant ID: vg0724417110 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24417110
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACATACTTTAACCATTAATTTATCTCATATTATGTTTCCAACAAAAATGAAATTAGCATCACATGAAAATACTTTAAAATATAAATATAAATCTAGTG[A/T]
TATTGGTTAAGTGTAAAGTTATCGAGTCTGATTTTCCTTTAAAGGATGTCCTATAATTTGCGACAAATGGAGTAATATGAAAACACAGGTTACAATCGTA

Reverse complement sequence

TACGATTGTAACCTGTGTTTTCATATTACTCCATTTGTCGCAAATTATAGGACATCCTTTAAAGGAAAATCAGACTCGATAACTTTACACTTAACCAATA[T/A]
CACTAGATTTATATTTATATTTTAAAGTATTTTCATGTGATGCTAATTTCATTTTTGTTGGAAACATAATATGAGATAAATTAATGGTTAAAGTATGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 6.80% 0.06% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 81.00% 18.80% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 68.20% 31.80% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 14.50% 1.24% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724417110 A -> T LOC_Os07g40730.1 downstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0724417110 A -> T LOC_Os07g40740.1 downstream_gene_variant ; 273.0bp to feature; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0724417110 A -> T LOC_Os07g40750.1 downstream_gene_variant ; 2773.0bp to feature; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0724417110 A -> T LOC_Os07g40730.2 downstream_gene_variant ; 1260.0bp to feature; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0724417110 A -> T LOC_Os07g40730.3 downstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0724417110 A -> T LOC_Os07g40730-LOC_Os07g40740 intergenic_region ; MODIFIER silent_mutation Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724417110 NA 9.73E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724417110 1.54E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 7.78E-08 5.90E-11 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 2.55E-13 4.52E-16 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 4.53E-10 4.53E-10 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.44E-24 5.16E-20 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 2.36E-18 1.09E-24 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 3.19E-26 5.08E-28 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.24E-13 4.65E-16 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.66E-11 3.22E-18 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 2.70E-07 1.49E-08 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 4.54E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 5.35E-09 9.83E-12 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 3.26E-07 NA mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.18E-06 1.18E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 7.70E-35 9.87E-24 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 7.08E-26 1.01E-30 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 9.04E-13 8.97E-16 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 5.40E-08 7.86E-11 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 NA 3.92E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 2.09E-11 7.48E-24 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.75E-06 2.51E-10 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 3.57E-07 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 1.56E-06 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 8.08E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 8.88E-36 3.21E-37 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 8.49E-17 1.17E-20 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 5.10E-08 7.72E-19 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 7.06E-33 1.46E-43 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724417110 9.35E-16 1.50E-20 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251