\
| Variant ID: vg0724417110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24417110 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACATACTTTAACCATTAATTTATCTCATATTATGTTTCCAACAAAAATGAAATTAGCATCACATGAAAATACTTTAAAATATAAATATAAATCTAGTG[A/T]
TATTGGTTAAGTGTAAAGTTATCGAGTCTGATTTTCCTTTAAAGGATGTCCTATAATTTGCGACAAATGGAGTAATATGAAAACACAGGTTACAATCGTA
TACGATTGTAACCTGTGTTTTCATATTACTCCATTTGTCGCAAATTATAGGACATCCTTTAAAGGAAAATCAGACTCGATAACTTTACACTTAACCAATA[T/A]
CACTAGATTTATATTTATATTTTAAAGTATTTTCATGTGATGCTAATTTCATTTTTGTTGGAAACATAATATGAGATAAATTAATGGTTAAAGTATGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 18.80% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.20% | 31.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 14.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724417110 | A -> T | LOC_Os07g40730.1 | downstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0724417110 | A -> T | LOC_Os07g40740.1 | downstream_gene_variant ; 273.0bp to feature; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0724417110 | A -> T | LOC_Os07g40750.1 | downstream_gene_variant ; 2773.0bp to feature; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0724417110 | A -> T | LOC_Os07g40730.2 | downstream_gene_variant ; 1260.0bp to feature; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0724417110 | A -> T | LOC_Os07g40730.3 | downstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0724417110 | A -> T | LOC_Os07g40730-LOC_Os07g40740 | intergenic_region ; MODIFIER | silent_mutation | Average:40.913; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724417110 | NA | 9.73E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724417110 | 1.54E-06 | NA | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 7.78E-08 | 5.90E-11 | mr1138 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 2.55E-13 | 4.52E-16 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 4.53E-10 | 4.53E-10 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.44E-24 | 5.16E-20 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 2.36E-18 | 1.09E-24 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 3.19E-26 | 5.08E-28 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.24E-13 | 4.65E-16 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.66E-11 | 3.22E-18 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 2.70E-07 | 1.49E-08 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 4.54E-06 | NA | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 5.35E-09 | 9.83E-12 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 3.26E-07 | NA | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.18E-06 | 1.18E-06 | mr1181_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 7.70E-35 | 9.87E-24 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 7.08E-26 | 1.01E-30 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 9.04E-13 | 8.97E-16 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 5.40E-08 | 7.86E-11 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | NA | 3.92E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 2.09E-11 | 7.48E-24 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.75E-06 | 2.51E-10 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 3.57E-07 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 1.56E-06 | NA | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 8.08E-06 | NA | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 8.88E-36 | 3.21E-37 | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 8.49E-17 | 1.17E-20 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 5.10E-08 | 7.72E-19 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 7.06E-33 | 1.46E-43 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724417110 | 9.35E-16 | 1.50E-20 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |