\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724401667:

Variant ID: vg0724401667 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24401667
Reference Allele: CAlternative Allele: G,CG
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, C: 0.19, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTAAATTTAAATTTAAATTCAAATATTTTTTTATATATAGTATTTTCTATACATATAAAGTTTATATACCTTAAGTTTATAGAACCAAAGTTTATAA[C/G,CG]
TCAAATGTTTATATACCCATTTAAATTTGAATTTGAATTAAAAAAAAAAGTAGAAACACTGGTCGGGGCGGGGGGAGCTGGGGGAGGAGACCAGCGAGAC

Reverse complement sequence

GTCTCGCTGGTCTCCTCCCCCAGCTCCCCCCGCCCCGACCAGTGTTTCTACTTTTTTTTTTAATTCAAATTCAAATTTAAATGGGTATATAAACATTTGA[G/C,CG]
TTATAAACTTTGGTTCTATAAACTTAAGGTATATAAACTTTATATGTATAGAAAATACTATATATAAAAAAATATTTGAATTTAAATTTAAATTTAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 11.50% 6.39% 0.42% CG: 6.28%
All Indica  2759 97.20% 1.50% 0.36% 0.00% CG: 0.98%
All Japonica  1512 47.90% 32.50% 17.66% 1.26% CG: 0.66%
Aus  269 20.80% 0.40% 0.74% 0.00% CG: 78.07%
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 97.20% 1.50% 1.29% 0.00% NA
Indica III  913 99.20% 0.10% 0.00% 0.00% CG: 0.66%
Indica Intermediate  786 94.00% 2.90% 0.38% 0.00% CG: 2.67%
Temperate Japonica  767 7.30% 60.10% 30.12% 2.22% CG: 0.26%
Tropical Japonica  504 98.00% 0.40% 1.39% 0.20% NA
Japonica Intermediate  241 72.60% 11.60% 12.03% 0.41% CG: 3.32%
VI/Aromatic  96 34.40% 0.00% 18.75% 0.00% CG: 46.88%
Intermediate  90 76.70% 11.10% 5.56% 1.11% CG: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724401667 C -> DEL N N silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40730.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40730.2 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40730.3 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40710.1 downstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40710.2 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> G LOC_Os07g40710-LOC_Os07g40730 intergenic_region ; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40730.1 upstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40730.2 upstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40730.3 upstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40710.1 downstream_gene_variant ; 880.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40710.2 downstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg0724401667 C -> CG LOC_Os07g40710-LOC_Os07g40730 intergenic_region ; MODIFIER silent_mutation Average:76.005; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724401667 C CG 0.06 0.03 0.02 0.07 0.04 0.07
vg0724401667 C G 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724401667 7.84E-07 NA mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 7.86E-17 3.72E-10 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 2.95E-14 5.14E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 2.49E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 5.81E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 1.35E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 6.69E-06 6.67E-06 mr1703 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 4.95E-06 NA mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 2.30E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.08E-12 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 2.26E-11 NA mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.13E-06 NA mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 4.71E-07 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 3.62E-12 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.40E-27 9.22E-10 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 4.29E-22 5.59E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 4.89E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 3.07E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 4.08E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 2.87E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 2.89E-08 NA mr1567_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.97E-06 NA mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 6.31E-11 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 7.69E-07 NA mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 NA 7.24E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 6.99E-21 3.63E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 4.98E-15 2.71E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.76E-06 NA mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 3.38E-19 NA mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401667 1.22E-13 NA mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251