Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724401578:

Variant ID: vg0724401578 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24401578
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATACATCTAAAGTTTATACACCTCAAGTCTATAGACCCAAAGTTTATAAGTCAAAAGTTTATATATCCGATTCAAATTTATATATTCGATTTAAATTT[A/G]
AATTTAAATTCAAATATTTTTTTATATATAGTATTTTCTATACATATAAAGTTTATATACCTTAAGTTTATAGAACCAAAGTTTATAACTCAAATGTTTA

Reverse complement sequence

TAAACATTTGAGTTATAAACTTTGGTTCTATAAACTTAAGGTATATAAACTTTATATGTATAGAAAATACTATATATAAAAAAATATTTGAATTTAAATT[T/C]
AAATTTAAATCGAATATATAAATTTGAATCGGATATATAAACTTTTGACTTATAAACTTTGGGTCTATAGACTTGAGGTGTATAAACTTTAGATGTATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.10% 21.10% 2.12% 0.66% NA
All Indica  2759 96.70% 2.60% 0.58% 0.11% NA
All Japonica  1512 53.00% 41.30% 3.77% 1.85% NA
Aus  269 15.60% 78.40% 5.95% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 90.80% 7.10% 1.72% 0.43% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 3.80% 0.89% 0.13% NA
Temperate Japonica  767 93.50% 5.90% 0.39% 0.26% NA
Tropical Japonica  504 3.20% 84.10% 7.94% 4.76% NA
Japonica Intermediate  241 28.60% 64.70% 5.81% 0.83% NA
VI/Aromatic  96 26.00% 70.80% 3.12% 0.00% NA
Intermediate  90 66.70% 24.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724401578 A -> DEL N N silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40730.1 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40730.2 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40730.3 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40710.1 downstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40710.2 downstream_gene_variant ; 3873.0bp to feature; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0724401578 A -> G LOC_Os07g40710-LOC_Os07g40730 intergenic_region ; MODIFIER silent_mutation Average:67.001; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724401578 NA 1.41E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.03E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.91E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.77E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.16E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.53E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.54E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.74E-07 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.53E-14 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.80E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.42E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.35E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.86E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.46E-16 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.12E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 9.10E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.95E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.31E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.22E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.19E-14 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 9.97E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.69E-09 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.07E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.04E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 9.14E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.34E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.61E-11 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.10E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.02E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.98E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.78E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 9.59E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.91E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.17E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.03E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.30E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.47E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 5.43E-10 mr1623_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.97E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 9.23E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.93E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.96E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.00E-12 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.76E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.16E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 2.45E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.62E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 1.56E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 3.12E-09 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724401578 NA 4.18E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251