\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724383895:

Variant ID: vg0724383895 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24383895
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGACCCTAGTTTCATCCATTTTCTGGTATTCAGAATTCTTTCTCGAATTGTGATCCCTTTTGACCATTACATTGGGAAACTCCTCTATCCTAAAGA[T/C]
ATTTTTTTTCTCAACAACTCAACACACAGACTATTGTATGAGGACTCAATTTTCATAACTCATTTGGCCGATAGAACAGTGTTCAGCATTCTAGTTTTAG

Reverse complement sequence

CTAAAACTAGAATGCTGAACACTGTTCTATCGGCCAAATGAGTTATGAAAATTGAGTCCTCATACAATAGTCTGTGTGTTGAGTTGTTGAGAAAAAAAAT[A/G]
TCTTTAGGATAGAGGAGTTTCCCAATGTAATGGTCAAAAGGGATCACAATTCGAGAAAGAATTCTGAATACCAGAAAATGGATGAAACTAGGGTCATAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 3.90% 8.13% 3.77% NA
All Indica  2759 88.90% 0.30% 7.32% 3.44% NA
All Japonica  1512 85.80% 11.50% 2.58% 0.13% NA
Aus  269 34.20% 0.00% 41.26% 24.54% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 91.80% 1.50% 6.02% 0.65% NA
Indica III  913 83.70% 0.00% 10.62% 5.70% NA
Indica Intermediate  786 85.20% 0.10% 9.54% 5.09% NA
Temperate Japonica  767 74.30% 21.40% 4.30% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 3.30% 2.49% 0.83% NA
VI/Aromatic  96 62.50% 0.00% 25.00% 12.50% NA
Intermediate  90 84.40% 3.30% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724383895 T -> DEL N N silent_mutation Average:48.888; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg0724383895 T -> C LOC_Os07g40690.1 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:48.888; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg0724383895 T -> C LOC_Os07g40680-LOC_Os07g40690 intergenic_region ; MODIFIER silent_mutation Average:48.888; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724383895 T C -0.03 -0.02 -0.01 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724383895 9.89E-07 8.49E-07 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 9.17E-12 2.53E-12 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 3.20E-07 1.49E-08 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 NA 2.83E-07 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 NA 5.70E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 5.31E-06 5.31E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 NA 1.78E-06 mr1182_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 5.65E-13 1.67E-14 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 NA 1.12E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 6.47E-06 5.79E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724383895 3.36E-07 2.88E-10 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251