\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724377253:

Variant ID: vg0724377253 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24377253
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCTTGATCTTTTTCGCTTTTACTATGAACTGCGTTGGATGGAATCCAACAGGGTATCTGGTTGCGTCGGGTTCCGACTTCGGGATGGCCTGAAGTTGC[G/A]
TTACGTTCCCTTCCAGTGCCCTTCTTCTCGCAGCAAGTGGAGGAATAGGTGGTTTTATCTTGAGATCAAGAACTCGAACCCTGTCTTCGTGGTTCCTGAA

Reverse complement sequence

TTCAGGAACCACGAAGACAGGGTTCGAGTTCTTGATCTCAAGATAAAACCACCTATTCCTCCACTTGCTGCGAGAAGAAGGGCACTGGAAGGGAACGTAA[C/T]
GCAACTTCAGGCCATCCCGAAGTCGGAACCCGACGCAACCAGATACCCTGTTGGATTCCATCCAACGCAGTTCATAGTAAAAGCGAAAAAGATCAAGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 0.20% 7.66% 51.02% NA
All Indica  2759 33.20% 0.20% 7.50% 59.04% NA
All Japonica  1512 53.20% 0.20% 0.53% 46.03% NA
Aus  269 40.50% 0.00% 43.12% 16.36% NA
Indica I  595 87.10% 0.00% 0.67% 12.27% NA
Indica II  465 20.00% 0.00% 4.09% 75.91% NA
Indica III  913 3.40% 0.40% 11.50% 84.67% NA
Indica Intermediate  786 35.00% 0.30% 10.05% 54.71% NA
Temperate Japonica  767 93.50% 0.00% 0.00% 6.52% NA
Tropical Japonica  504 3.00% 0.40% 0.60% 96.03% NA
Japonica Intermediate  241 30.30% 0.40% 2.07% 67.22% NA
VI/Aromatic  96 74.00% 0.00% 22.92% 3.12% NA
Intermediate  90 46.70% 0.00% 10.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724377253 G -> DEL LOC_Os07g40680.1 N frameshift_variant Average:25.137; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0724377253 G -> A LOC_Os07g40680.1 missense_variant ; p.Arg134His; MODERATE nonsynonymous_codon ; R134H Average:25.137; most accessible tissue: Zhenshan97 flower, score: 52.192 benign 0.667 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724377253 3.24E-06 2.52E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 NA 5.75E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 NA 3.23E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 5.09E-06 5.09E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 2.54E-06 2.54E-06 mr1286_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 4.15E-07 4.15E-07 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 4.22E-06 4.22E-06 mr1369_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 2.97E-06 2.97E-06 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 NA 8.06E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 1.37E-06 7.21E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 6.25E-06 6.25E-06 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 3.46E-06 2.92E-07 mr1812_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 NA 5.19E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 1.64E-06 1.64E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 NA 5.51E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 2.39E-06 2.39E-06 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724377253 1.86E-06 1.86E-06 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251