\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724376037:

Variant ID: vg0724376037 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24376037
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GTATTGGGGTACGTTGATACAAGGATCTACGTAGTACGACATCAAGCAAACAAAAGACAAGAATTATACTGGTTCAGACCCCTTGATAGGTAATAGCCCT[A/G]
GTCCAGTTGATGTGGAATTATATGGTAGAAAACACAGGTTACAAAGAGAACAAGGGAACTTGTCGGATCCGGCGAGATTGTAGTCGAGTTGATTCGACTA

Reverse complement sequence

TAGTCGAATCAACTCGACTACAATCTCGCCGGATCCGACAAGTTCCCTTGTTCTCTTTGTAACCTGTGTTTTCTACCATATAATTCCACATCAACTGGAC[T/C]
AGGGCTATTACCTATCAAGGGGTCTGAACCAGTATAATTCTTGTCTTTTGTTTGCTTGATGTCGTACTACGTAGATCCTTGTATCAACGTACCCCAATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 25.90% 0.15% 0.00% NA
All Indica  2759 71.60% 28.30% 0.14% 0.00% NA
All Japonica  1512 81.20% 18.80% 0.00% 0.00% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 16.00% 83.90% 0.17% 0.00% NA
Indica II  465 86.00% 14.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 73.20% 26.50% 0.38% 0.00% NA
Temperate Japonica  767 70.40% 29.60% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 62.50% 2.08% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724376037 A -> G LOC_Os07g40680.1 upstream_gene_variant ; 816.0bp to feature; MODIFIER silent_mutation Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0724376037 A -> G LOC_Os07g40660.1 downstream_gene_variant ; 4994.0bp to feature; MODIFIER silent_mutation Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0724376037 A -> G LOC_Os07g40670.1 downstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0724376037 A -> G LOC_Os07g40670-LOC_Os07g40680 intergenic_region ; MODIFIER silent_mutation Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724376037 3.61E-06 9.51E-09 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 8.99E-06 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 7.03E-07 7.03E-07 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 2.31E-11 2.91E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.15E-11 1.58E-16 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.22E-08 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 2.92E-09 6.03E-12 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 3.14E-06 2.64E-08 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.46E-07 NA mr1181_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 8.18E-06 8.18E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.85E-14 1.24E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 6.22E-15 8.63E-20 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 NA 7.85E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 5.20E-07 2.66E-09 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.22E-11 3.93E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 3.05E-12 6.78E-16 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 1.01E-08 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037 3.30E-10 4.16E-14 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251