Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724376037:

Variant ID: vg0724376037 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24376037
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

GTATTGGGGTACGTTGATACAAGGATCTACGTAGTACGACATCAAGCAAACAAAAGACAAGAATTATACTGGTTCAGACCCCTTGATAGGTAATAGCCCT[A/G]
GTCCAGTTGATGTGGAATTATATGGTAGAAAACACAGGTTACAAAGAGAACAAGGGAACTTGTCGGATCCGGCGAGATTGTAGTCGAGTTGATTCGACTA

Reverse complement sequence

TAGTCGAATCAACTCGACTACAATCTCGCCGGATCCGACAAGTTCCCTTGTTCTCTTTGTAACCTGTGTTTTCTACCATATAATTCCACATCAACTGGAC[T/C]
AGGGCTATTACCTATCAAGGGGTCTGAACCAGTATAATTCTTGTCTTTTGTTTGCTTGATGTCGTACTACGTAGATCCTTGTATCAACGTACCCCAATAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	25.90%	0.15%	0.00%	NA
All Indica	2759	71.60%	28.30%	0.14%	0.00%	NA
All Japonica	1512	81.20%	18.80%	0.00%	0.00%	NA
Aus	269	68.40%	31.60%	0.00%	0.00%	NA
Indica I	595	16.00%	83.90%	0.17%	0.00%	NA
Indica II	465	86.00%	14.00%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	73.20%	26.50%	0.38%	0.00%	NA
Temperate Japonica	767	70.40%	29.60%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	78.80%	21.20%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	62.50%	2.08%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724376037	A -> G	LOC_Os07g40680.1	upstream_gene_variant ; 816.0bp to feature; MODIFIER	silent_mutation	Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0724376037	A -> G	LOC_Os07g40660.1	downstream_gene_variant ; 4994.0bp to feature; MODIFIER	silent_mutation	Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0724376037	A -> G	LOC_Os07g40670.1	downstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0724376037	A -> G	LOC_Os07g40670-LOC_Os07g40680	intergenic_region ; MODIFIER	silent_mutation	Average:36.882; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724376037	3.61E-06	9.51E-09	mr1138	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	8.99E-06	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	7.03E-07	7.03E-07	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	2.31E-11	2.91E-12	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.15E-11	1.58E-16	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.22E-08	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	2.92E-09	6.03E-12	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	3.14E-06	2.64E-08	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.46E-07	NA	mr1181_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	8.18E-06	8.18E-06	mr1181_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.85E-14	1.24E-11	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	6.22E-15	8.63E-20	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	NA	7.85E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	5.20E-07	2.66E-09	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.22E-11	3.93E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	3.05E-12	6.78E-16	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	1.01E-08	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724376037	3.30E-10	4.16E-14	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251