\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724340832:

Variant ID: vg0724340832 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24340832
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGTGATTAATTGAGTTTTAATTATTACAAACTTAAAAAATAGATTAATACGATATTTTAGAGCAATTTTCATATAGAAAGTATTCCCATAAAACGCAC[C/T]
GTTTAGCCGTTTGAAAAATATGTCACTGAGTATCCAAAATTTTATCTCTGCTAGTAGAGGAAACGAACAGGGCTCACATTAAAGAAGAATGTTGCTAAGC

Reverse complement sequence

GCTTAGCAACATTCTTCTTTAATGTGAGCCCTGTTCGTTTCCTCTACTAGCAGAGATAAAATTTTGGATACTCAGTGACATATTTTTCAAACGGCTAAAC[G/A]
GTGCGTTTTATGGGAATACTTTCTATATGAAAATTGCTCTAAAATATCGTATTAATCTATTTTTTAAGTTTGTAATAATTAAAACTCAATTAATCACACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 45.50% 0.23% 0.11% NA
All Indica  2759 69.10% 30.60% 0.22% 0.11% NA
All Japonica  1512 33.10% 66.70% 0.20% 0.07% NA
Aus  269 16.70% 83.30% 0.00% 0.00% NA
Indica I  595 15.80% 84.00% 0.00% 0.17% NA
Indica II  465 78.10% 21.50% 0.22% 0.22% NA
Indica III  913 98.50% 1.30% 0.11% 0.11% NA
Indica Intermediate  786 70.00% 29.50% 0.51% 0.00% NA
Temperate Japonica  767 60.10% 39.80% 0.13% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 13.30% 85.90% 0.41% 0.41% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 58.90% 37.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724340832 C -> DEL N N silent_mutation Average:84.933; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0724340832 C -> T LOC_Os07g40610.1 upstream_gene_variant ; 4227.0bp to feature; MODIFIER silent_mutation Average:84.933; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0724340832 C -> T LOC_Os07g40620.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:84.933; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0724340832 C -> T LOC_Os07g40610-LOC_Os07g40620 intergenic_region ; MODIFIER silent_mutation Average:84.933; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724340832 C T 0.01 -0.01 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724340832 8.99E-06 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 4.30E-09 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 2.66E-11 7.09E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 2.88E-07 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 2.61E-09 NA mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 9.16E-07 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 NA 7.46E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 NA 6.05E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 3.01E-11 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 6.78E-18 3.45E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 NA 5.76E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 3.87E-08 NA mr1679_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 1.57E-10 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 3.33E-13 1.27E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 1.19E-07 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724340832 1.01E-12 NA mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251