\
| Variant ID: vg0724294065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24294065 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
ATCAATGCAGAAAAGTATGTACTGAATATGAATCAAAATTACCTCTACTGAACCATGATTTCCGAACTACTTGCCGGATGTGGCGCTCATGTTTCTCTAA[T/C]
AGTTCATCAACCTTGTGTGACTGAGATAACAAAGGGCCAGAATATTCAACCCTCTCTCCTTGATCATGATCACCCTAAAGGTTTAAACAACACACTGTTT
AAACAGTGTGTTGTTTAAACCTTTAGGGTGATCATGATCAAGGAGAGAGGGTTGAATATTCTGGCCCTTTGTTATCTCAGTCACACAAGGTTGATGAACT[A/G]
TTAGAGAAACATGAGCGCCACATCCGGCAAGTAGTTCGGAAATCATGGTTCAGTAGAGGTAATTTTGATTCATATTCAGTACATACTTTTCTGCATTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.30% | 31.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 40.30% | 59.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724294065 | T -> C | LOC_Os07g40550.1 | synonymous_variant ; p.Leu685Leu; LOW | synonymous_codon | Average:53.572; most accessible tissue: Callus, score: 85.698 | N | N | N | N |
| vg0724294065 | T -> C | LOC_Os07g40550.2 | synonymous_variant ; p.Leu685Leu; LOW | synonymous_codon | Average:53.572; most accessible tissue: Callus, score: 85.698 | N | N | N | N |
| vg0724294065 | T -> C | LOC_Os07g40550.3 | synonymous_variant ; p.Leu513Leu; LOW | synonymous_codon | Average:53.572; most accessible tissue: Callus, score: 85.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724294065 | 4.40E-09 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 8.63E-21 | 2.12E-12 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 6.46E-15 | 1.47E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.10E-12 | NA | mr1829 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.72E-11 | NA | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.17E-07 | NA | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 4.67E-07 | NA | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 4.65E-07 | NA | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.53E-30 | 2.12E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 3.26E-23 | 1.51E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | NA | 6.76E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 4.88E-08 | NA | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 3.62E-06 | NA | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.52E-10 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 2.29E-06 | NA | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 8.42E-21 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 1.18E-14 | 1.99E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 7.71E-19 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724294065 | 9.60E-14 | 6.73E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |