Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724290261:

Variant ID: vg0724290261 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24290261
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGACAGGTTCGGGCCGCTGAGAAGCGTAACACCCTACTCCTGTGTTCTGGTGGATCTGTGTGTGAAGGAATACAAAGAACCGGAGAGCGAGAGTGAGT[C/T]
CAGGCTCTAGAACCCCTTCCCCAGAGTCCCCAAAAAAACCCCCTTTCTCCTAGGCCTGGGCCTCCTTTTTATCTGGTCAGGGGTCAACACATGGGCCTCT

Reverse complement sequence

AGAGGCCCATGTGTTGACCCCTGACCAGATAAAAAGGAGGCCCAGGCCTAGGAGAAAGGGGGTTTTTTTGGGGACTCTGGGGAAGGGGTTCTAGAGCCTG[G/A]
ACTCACTCTCGCTCTCCGGTTCTTTGTATTCCTTCACACACAGATCCACCAGAACACAGGAGTAGGGTGTTACGCTTCTCAGCGGCCCGAACCTGTCTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.10%	14.90%	6.71%	32.29%	NA
All Indica	2759	37.50%	1.10%	8.45%	52.95%	NA
All Japonica	1512	55.30%	43.60%	0.86%	0.26%	NA
Aus	269	84.00%	0.00%	7.06%	8.92%	NA
Indica I	595	85.40%	0.80%	1.34%	12.44%	NA
Indica II	465	20.90%	3.90%	3.87%	71.40%	NA
Indica III	913	16.20%	0.10%	15.33%	68.35%	NA
Indica Intermediate	786	35.90%	0.80%	8.52%	54.83%	NA
Temperate Japonica	767	18.10%	81.40%	0.26%	0.26%	NA
Tropical Japonica	504	98.40%	0.80%	0.60%	0.20%	NA
Japonica Intermediate	241	83.40%	12.90%	3.32%	0.41%	NA
VI/Aromatic	96	44.80%	0.00%	40.62%	14.58%	NA
Intermediate	90	43.30%	16.70%	14.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724290261	C -> DEL	N	N	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40540.1	upstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40530.1	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40550.1	downstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40550.2	downstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40550.3	downstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg0724290261	C -> T	LOC_Os07g40530-LOC_Os07g40540	intergenic_region ; MODIFIER	silent_mutation	Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724290261	2.11E-07	7.06E-18	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	3.31E-09	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	8.25E-06	1.63E-14	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	3.45E-08	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	9.20E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	3.31E-06	3.52E-16	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	4.84E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	1.40E-12	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	3.12E-07	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	6.71E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	4.72E-06	4.71E-06	mr1703	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	8.98E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	3.52E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	4.49E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	8.99E-08	9.58E-20	mr1182_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	8.67E-11	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	1.17E-13	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	8.13E-08	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	8.84E-34	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	1.46E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	8.91E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	6.39E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	2.16E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	1.23E-16	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261	NA	6.64E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251