\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724290261:

Variant ID: vg0724290261 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24290261
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGACAGGTTCGGGCCGCTGAGAAGCGTAACACCCTACTCCTGTGTTCTGGTGGATCTGTGTGTGAAGGAATACAAAGAACCGGAGAGCGAGAGTGAGT[C/T]
CAGGCTCTAGAACCCCTTCCCCAGAGTCCCCAAAAAAACCCCCTTTCTCCTAGGCCTGGGCCTCCTTTTTATCTGGTCAGGGGTCAACACATGGGCCTCT

Reverse complement sequence

AGAGGCCCATGTGTTGACCCCTGACCAGATAAAAAGGAGGCCCAGGCCTAGGAGAAAGGGGGTTTTTTTGGGGACTCTGGGGAAGGGGTTCTAGAGCCTG[G/A]
ACTCACTCTCGCTCTCCGGTTCTTTGTATTCCTTCACACACAGATCCACCAGAACACAGGAGTAGGGTGTTACGCTTCTCAGCGGCCCGAACCTGTCTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 14.90% 6.71% 32.29% NA
All Indica  2759 37.50% 1.10% 8.45% 52.95% NA
All Japonica  1512 55.30% 43.60% 0.86% 0.26% NA
Aus  269 84.00% 0.00% 7.06% 8.92% NA
Indica I  595 85.40% 0.80% 1.34% 12.44% NA
Indica II  465 20.90% 3.90% 3.87% 71.40% NA
Indica III  913 16.20% 0.10% 15.33% 68.35% NA
Indica Intermediate  786 35.90% 0.80% 8.52% 54.83% NA
Temperate Japonica  767 18.10% 81.40% 0.26% 0.26% NA
Tropical Japonica  504 98.40% 0.80% 0.60% 0.20% NA
Japonica Intermediate  241 83.40% 12.90% 3.32% 0.41% NA
VI/Aromatic  96 44.80% 0.00% 40.62% 14.58% NA
Intermediate  90 43.30% 16.70% 14.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724290261 C -> DEL N N silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40540.1 upstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40530.1 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40550.1 downstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40550.2 downstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40550.3 downstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0724290261 C -> T LOC_Os07g40530-LOC_Os07g40540 intergenic_region ; MODIFIER silent_mutation Average:33.73; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724290261 2.11E-07 7.06E-18 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 3.31E-09 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 8.25E-06 1.63E-14 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 3.45E-08 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 9.20E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 3.31E-06 3.52E-16 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 4.84E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 1.40E-12 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 3.12E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 6.71E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 4.72E-06 4.71E-06 mr1703 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 8.98E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 3.52E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 4.49E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 8.99E-08 9.58E-20 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 8.67E-11 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 1.17E-13 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 8.13E-08 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 8.84E-34 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 1.46E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 8.91E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 6.39E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 2.16E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 1.23E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724290261 NA 6.64E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251