| Variant ID: vg0724248089 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 24248089 |
| Reference Allele: G | Alternative Allele: A,GTTTATGCA |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )
GTAATAATTTGATCTGAGCCTTGATCATGACTCGGACGATTACGACATAATGTGTCCTAATGCACCTTATTGGTATCCTCCTCTACAGTACAGTTTATAC[G/A,GTTTATGCA]
CTTAGGGCATGTATAAAGGTAGAGCTTAGAATGGTCTCTTTGTTAATACATATCACTTAGAGACTATTCTCCTACAATAGTTAAGATAACAAAAACTCTT
AAGAGTTTTTGTTATCTTAACTATTGTAGGAGAATAGTCTCTAAGTGATATGTATTAACAAAGAGACCATTCTAAGCTCTACCTTTATACATGCCCTAAG[C/T,TGCATAAAC]
GTATAAACTGTACTGTAGAGGAGGATACCAATAAGGTGCATTAGGACACATTATGTCGTAATCGTCCGAGTCATGATCAAGGCTCAGATCAAATTATTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 14.60% | 0.02% | 0.00% | GTTTATGCA: 0.02% |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.90% | 43.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.00% | GTTTATGCA: 0.37% |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 19.30% | 80.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40450.1 | upstream_gene_variant ; 4721.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40470.1 | upstream_gene_variant ; 1966.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40450.2 | upstream_gene_variant ; 4721.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40460.1 | downstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40480.1 | downstream_gene_variant ; 4833.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40460.2 | downstream_gene_variant ; 2650.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40460.3 | downstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> GTTTATGCA | LOC_Os07g40460-LOC_Os07g40470 | intergenic_region ; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40450.1 | upstream_gene_variant ; 4720.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40470.1 | upstream_gene_variant ; 1967.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40450.2 | upstream_gene_variant ; 4720.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40460.1 | downstream_gene_variant ; 615.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40480.1 | downstream_gene_variant ; 4834.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40460.2 | downstream_gene_variant ; 2649.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40460.3 | downstream_gene_variant ; 615.0bp to feature; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg0724248089 | G -> A | LOC_Os07g40460-LOC_Os07g40470 | intergenic_region ; MODIFIER | silent_mutation | Average:54.919; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724248089 | 8.58E-08 | 2.24E-18 | mr1182 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 4.16E-09 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | 2.94E-06 | 4.43E-15 | mr1282 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 6.62E-08 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 2.75E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | 9.26E-07 | 1.00E-16 | mr1650 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 6.42E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 5.50E-13 | mr1658 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 6.59E-07 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.26E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | 1.00E-07 | 1.03E-19 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.59E-10 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.02E-13 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.05E-07 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 6.48E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 2.43E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.01E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | 2.82E-06 | NA | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 1.50E-13 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 9.87E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724248089 | NA | 3.88E-15 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |