Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724216200:

Variant ID: vg0724216200 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24216200
Reference Allele: G	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CAGGATGAGTATAAAGAGTAAAAGGCTAACAGAAACTTGAGTCGGGGCAGAAAGGCCCACCAGTCCCCTGCGAATTTCATCCCAAAATTCATTGGAATTC[G/A,C]
TAAGATCATAGTCTTGGGGCTCGTCAGGTCCCGAGAAAACATATTTCAGTGTTGACAAGTAGAGAGAGAGAGAGAGAGTATGCTATAAGCATCCAGGCGC

Reverse complement sequence

GCGCCTGGATGCTTATAGCATACTCTCTCTCTCTCTCTCTACTTGTCAACACTGAAATATGTTTTCTCGGGACCTGACGAGCCCCAAGACTATGATCTTA[C/T,G]
GAATTCCAATGAATTTTGGGATGAAATTCGCAGGGGACTGGTGGGCCTTTCTGCCCCGACTCAAGTTTCTGTTAGCCTTTTACTCTTTATACTCATCCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	14.90%	0.00%	0.00%	C: 0.02%
All Indica	2759	99.20%	0.80%	0.00%	0.00%	C: 0.04%
All Japonica	1512	55.60%	44.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.60%	0.00%	0.00%	C: 0.13%
Temperate Japonica	767	19.30%	80.70%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	4.40%	0.00%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724216200	G -> A	LOC_Os07g40380.1	downstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0724216200	G -> A	LOC_Os07g40404.1	downstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0724216200	G -> A	LOC_Os07g40390.1	intron_variant ; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0724216200	G -> C	LOC_Os07g40380.1	downstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0724216200	G -> C	LOC_Os07g40404.1	downstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0724216200	G -> C	LOC_Os07g40390.1	intron_variant ; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724216200	NA	3.48E-15	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	7.87E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	3.09E-12	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	7.72E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	1.71E-13	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	9.13E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	1.55E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	5.17E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	2.73E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	5.07E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	2.10E-17	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	5.55E-09	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	3.68E-12	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	1.54E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	1.19E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	2.04E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	7.64E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	6.43E-07	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	9.24E-08	NA	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	7.43E-06	NA	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	6.95E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200	NA	8.87E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251