\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724216200:

Variant ID: vg0724216200 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24216200
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGATGAGTATAAAGAGTAAAAGGCTAACAGAAACTTGAGTCGGGGCAGAAAGGCCCACCAGTCCCCTGCGAATTTCATCCCAAAATTCATTGGAATTC[G/A,C]
TAAGATCATAGTCTTGGGGCTCGTCAGGTCCCGAGAAAACATATTTCAGTGTTGACAAGTAGAGAGAGAGAGAGAGAGTATGCTATAAGCATCCAGGCGC

Reverse complement sequence

GCGCCTGGATGCTTATAGCATACTCTCTCTCTCTCTCTCTACTTGTCAACACTGAAATATGTTTTCTCGGGACCTGACGAGCCCCAAGACTATGATCTTA[C/T,G]
GAATTCCAATGAATTTTGGGATGAAATTCGCAGGGGACTGGTGGGCCTTTCTGCCCCGACTCAAGTTTCTGTTAGCCTTTTACTCTTTATACTCATCCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 14.90% 0.00% 0.00% C: 0.02%
All Indica  2759 99.20% 0.80% 0.00% 0.00% C: 0.04%
All Japonica  1512 55.60% 44.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 19.30% 80.70% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724216200 G -> A LOC_Os07g40380.1 downstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0724216200 G -> A LOC_Os07g40404.1 downstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0724216200 G -> A LOC_Os07g40390.1 intron_variant ; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0724216200 G -> C LOC_Os07g40380.1 downstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0724216200 G -> C LOC_Os07g40404.1 downstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0724216200 G -> C LOC_Os07g40390.1 intron_variant ; MODIFIER silent_mutation Average:57.019; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724216200 NA 3.48E-15 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 7.87E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 3.09E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 7.72E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 1.71E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 9.13E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 1.55E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 5.17E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 2.73E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 5.07E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 2.10E-17 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 5.55E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 3.68E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 1.54E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 1.19E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 2.04E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 7.64E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 6.43E-07 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 9.24E-08 NA mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 7.43E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 6.95E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724216200 NA 8.87E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251