Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724210345:

Variant ID: vg0724210345 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24210345
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTCAGTTGATTTGACATGTAAGTGCACTGTAATTTTGATAAAAATATTGTGTAAGTAAATATGTACTTATTATTTTCTTTAAAATATAAAATTACAGT[C/T]
TTATATAACTAAAATTACATATGTAAATTTAGTTGATATGACATGTAAGTGCACTGTAATTTTGATAAAAATATTGTGTAAGTAAATTTGCATTAGTTAT

Reverse complement sequence

ATAACTAATGCAAATTTACTTACACAATATTTTTATCAAAATTACAGTGCACTTACATGTCATATCAACTAAATTTACATATGTAATTTTAGTTATATAA[G/A]
ACTGTAATTTTATATTTTAAAGAAAATAATAAGTACATATTTACTTACACAATATTTTTATCAAAATTACAGTGCACTTACATGTCAAATCAACTGAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	0.10%	0.87%	17.86%	NA
All Indica	2759	96.30%	0.00%	0.43%	3.19%	NA
All Japonica	1512	52.90%	0.10%	1.46%	45.50%	NA
Aus	269	87.00%	0.70%	1.49%	10.78%	NA
Indica I	595	95.60%	0.20%	0.00%	4.20%	NA
Indica II	465	93.80%	0.00%	0.00%	6.24%	NA
Indica III	913	98.80%	0.00%	0.77%	0.44%	NA
Indica Intermediate	786	95.50%	0.00%	0.64%	3.82%	NA
Temperate Japonica	767	84.90%	0.00%	2.09%	13.04%	NA
Tropical Japonica	504	15.10%	0.20%	0.40%	84.33%	NA
Japonica Intermediate	241	30.30%	0.40%	1.66%	67.63%	NA
VI/Aromatic	96	75.00%	1.00%	2.08%	21.88%	NA
Intermediate	90	78.90%	0.00%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724210345	C -> DEL	N	N	silent_mutation	Average:41.049; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N
vg0724210345	C -> T	LOC_Os07g40370.1	upstream_gene_variant ; 2380.0bp to feature; MODIFIER	silent_mutation	Average:41.049; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N
vg0724210345	C -> T	LOC_Os07g40380.1	upstream_gene_variant ; 624.0bp to feature; MODIFIER	silent_mutation	Average:41.049; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N
vg0724210345	C -> T	LOC_Os07g40370-LOC_Os07g40380	intergenic_region ; MODIFIER	silent_mutation	Average:41.049; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724210345	NA	9.91E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	7.80E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	6.08E-07	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	3.28E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	9.89E-07	9.88E-07	mr1853	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	1.90E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	1.52E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	1.53E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	5.36E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724210345	NA	9.36E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251