\
| Variant ID: vg0724167005 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24167005 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGGGACATGTCAGGCTGCACGTCGCCTGACACACGAGCAGCGCACAGGCGCACTAGCCAGTCCCATCGGTCATTTGACCGGTCACAGACCGGTTGAGTG[C/T]
ACTGCACGCCGCATTAAATGTGGCGTGGCGCGACCGCTCGGGACGCCATAAATGCGGGTAAGTGGGCACCTGGAGACGGACATCTAACCCACCGTACGTG
CACGTACGGTGGGTTAGATGTCCGTCTCCAGGTGCCCACTTACCCGCATTTATGGCGTCCCGAGCGGTCGCGCCACGCCACATTTAATGCGGCGTGCAGT[G/A]
CACTCAACCGGTCTGTGACCGGTCAAATGACCGATGGGACTGGCTAGTGCGCCTGTGCGCTGCTCGTGTGTCAGGCGACGTGCAGCCTGACATGTCCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 22.00% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 4.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 48.50% | 51.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 82.50% | 17.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 23.20% | 75.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724167005 | C -> T | LOC_Os07g40300.1 | downstream_gene_variant ; 1964.0bp to feature; MODIFIER | silent_mutation | Average:49.388; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0724167005 | C -> T | LOC_Os07g40300-LOC_Os07g40310 | intergenic_region ; MODIFIER | silent_mutation | Average:49.388; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724167005 | 3.42E-06 | NA | mr1179 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 2.12E-08 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 3.76E-07 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 4.04E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 5.19E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 1.35E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 2.93E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 1.47E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 1.85E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | 4.06E-06 | 4.06E-06 | mr1853 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 5.15E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 4.90E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 9.16E-06 | mr1416_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724167005 | NA | 3.60E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |