Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724098043:

Variant ID: vg0724098043 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24098043
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCACAAGAGTCGACTAGGTTGTAGGAGCAGGAGACTGGATGTCTGGATCGCCGAACTTGGCAGGGACATGAGCAACAACGGGGCCAAGCGGGTTTGGA[G/A]
GGTAGACTTGCACAATCTGCCTTGTCAATCGCCGGAAGCCGTAGAGTCGACCTTGGAAGGGCAATGTGTTCAAGAGCTCCATGTCTTTGTGGATGACCTC

Reverse complement sequence

GAGGTCATCCACAAAGACATGGAGCTCTTGAACACATTGCCCTTCCAAGGTCGACTCTACGGCTTCCGGCGATTGACAAGGCAGATTGTGCAAGTCTACC[C/T]
TCCAAACCCGCTTGGCCCCGTTGTTGCTCATGTCCCTGCCAAGTTCGGCGATCCAGACATCCAGTCTCCTGCTCCTACAACCTAGTCGACTCTTGTGGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	17.20%	0.61%	0.00%	NA
All Indica	2759	96.80%	2.80%	0.40%	0.00%	NA
All Japonica	1512	58.30%	41.10%	0.66%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.80%	0.30%	0.84%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	97.80%	2.00%	0.22%	0.00%	NA
Indica Intermediate	786	97.30%	2.30%	0.38%	0.00%	NA
Temperate Japonica	767	92.60%	7.20%	0.26%	0.00%	NA
Tropical Japonica	504	18.10%	81.70%	0.20%	0.00%	NA
Japonica Intermediate	241	33.20%	63.90%	2.90%	0.00%	NA
VI/Aromatic	96	6.20%	90.60%	3.12%	0.00%	NA
Intermediate	90	65.60%	28.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724098043	G -> A	LOC_Os07g40170.1	upstream_gene_variant ; 3388.0bp to feature; MODIFIER	silent_mutation	Average:84.922; most accessible tissue: Callus, score: 93.808	N	N	N	N
vg0724098043	G -> A	LOC_Os07g40160.1	downstream_gene_variant ; 120.0bp to feature; MODIFIER	silent_mutation	Average:84.922; most accessible tissue: Callus, score: 93.808	N	N	N	N
vg0724098043	G -> A	LOC_Os07g40150-LOC_Os07g40160	intergenic_region ; MODIFIER	silent_mutation	Average:84.922; most accessible tissue: Callus, score: 93.808	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0724098043	G	A	-0.06	-0.05	-0.04	-0.05	-0.06	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724098043	NA	5.61E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	4.96E-09	mr1308	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	2.62E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	3.24E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	1.37E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	6.89E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724098043	NA	7.78E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251