\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724064070:

Variant ID: vg0724064070 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24064070
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTTCGGCAAAGGACGGTGGAGGGGTGCTCCAGGACAGCGCGCGCGCAGGGAACCCGACACGACTGCGAGGAGGTGAAGGTGCGGCGATGCCGCTTCCC[A/G]
GAAAGCTCCGGTGAGCTCACGGGCTTCAAATCCGGTAAGTAACCCGAACCCTTAGCATAATTGATTTGGATTTGACTCTTATGGTTCTTACCCGAAATTA

Reverse complement sequence

TAATTTCGGGTAAGAACCATAAGAGTCAAATCCAAATCAATTATGCTAAGGGTTCGGGTTACTTACCGGATTTGAAGCCCGTGAGCTCACCGGAGCTTTC[T/C]
GGGAAGCGGCATCGCCGCACCTTCACCTCCTCGCAGTCGTGTCGGGTTCCCTGCGCGCGCGCTGTCCTGGAGCACCCCTCCACCGTCCTTTGCCGAAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.70% 0.42% 0.00% NA
All Indica  2759 91.60% 8.00% 0.43% 0.00% NA
All Japonica  1512 1.50% 98.20% 0.26% 0.00% NA
Aus  269 90.30% 9.30% 0.37% 0.00% NA
Indica I  595 92.10% 7.40% 0.50% 0.00% NA
Indica II  465 88.00% 11.80% 0.22% 0.00% NA
Indica III  913 97.20% 2.60% 0.22% 0.00% NA
Indica Intermediate  786 86.90% 12.30% 0.76% 0.00% NA
Temperate Japonica  767 2.20% 97.70% 0.13% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 1.24% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 37.80% 58.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724064070 A -> G LOC_Os07g40090.1 upstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0724064070 A -> G LOC_Os07g40100.1 downstream_gene_variant ; 2665.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0724064070 A -> G LOC_Os07g40090-LOC_Os07g40100 intergenic_region ; MODIFIER silent_mutation Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724064070 NA 4.36E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724064070 NA 3.03E-08 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.25E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 3.79E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 1.32E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 8.08E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 5.00E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 9.53E-06 2.62E-08 mr1395 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.18E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.01E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.20E-08 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.89E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.72E-33 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 3.19E-06 1.74E-10 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.84E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.96E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 8.68E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 1.04E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.95E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 6.99E-08 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.84E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 4.74E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 2.31E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724064070 NA 7.39E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251