| Variant ID: vg0724064070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24064070 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 93. )
GTCTTCGGCAAAGGACGGTGGAGGGGTGCTCCAGGACAGCGCGCGCGCAGGGAACCCGACACGACTGCGAGGAGGTGAAGGTGCGGCGATGCCGCTTCCC[A/G]
GAAAGCTCCGGTGAGCTCACGGGCTTCAAATCCGGTAAGTAACCCGAACCCTTAGCATAATTGATTTGGATTTGACTCTTATGGTTCTTACCCGAAATTA
TAATTTCGGGTAAGAACCATAAGAGTCAAATCCAAATCAATTATGCTAAGGGTTCGGGTTACTTACCGGATTTGAAGCCCGTGAGCTCACCGGAGCTTTC[T/C]
GGGAAGCGGCATCGCCGCACCTTCACCTCCTCGCAGTCGTGTCGGGTTCCCTGCGCGCGCGCTGTCCTGGAGCACCCCTCCACCGTCCTTTGCCGAAGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 39.70% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 91.60% | 8.00% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 1.50% | 98.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.40% | 0.50% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.30% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 2.20% | 97.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 58.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724064070 | A -> G | LOC_Os07g40090.1 | upstream_gene_variant ; 2351.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| vg0724064070 | A -> G | LOC_Os07g40100.1 | downstream_gene_variant ; 2665.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| vg0724064070 | A -> G | LOC_Os07g40090-LOC_Os07g40100 | intergenic_region ; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724064070 | NA | 4.36E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724064070 | NA | 3.03E-08 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 4.25E-07 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 3.79E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 1.32E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 8.08E-06 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 5.00E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | 9.53E-06 | 2.62E-08 | mr1395 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 2.18E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724064070 | NA | 4.01E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/