Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724018707:

Variant ID: vg0724018707 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24018707
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGAGTAAAATGAAAGAAACAGACAACTTATTGAAGTAGCTTATTATAATCTGGAGCTAACTTATTATAATCTGATAAGCTCATTTAGGTGAGCTTTTT[C/T]
CAGATTATTGAGTGAAAAATTACCCACCATGCCACCCCACTTCCTCTTTAGACTTGCAAACCCAATAATCTAGACTCTAATAATCTAGAAAAGAAACAAC

Reverse complement sequence

GTTGTTTCTTTTCTAGATTATTAGAGTCTAGATTATTGGGTTTGCAAGTCTAAAGAGGAAGTGGGGTGGCATGGTGGGTAATTTTTCACTCAATAATCTG[G/A]
AAAAAGCTCACCTAAATGAGCTTATCAGATTATAATAAGTTAGCTCCAGATTATAATAAGCTACTTCAATAAGTTGTCTGTTTCTTTCATTTTACTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	2.90%	0.00%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	61.30%	38.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724018707	C -> T	LOC_Os07g40030.1	upstream_gene_variant ; 1670.0bp to feature; MODIFIER	silent_mutation	Average:48.448; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0724018707	C -> T	LOC_Os07g40030.2	upstream_gene_variant ; 1670.0bp to feature; MODIFIER	silent_mutation	Average:48.448; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0724018707	C -> T	LOC_Os07g40030.3	upstream_gene_variant ; 1670.0bp to feature; MODIFIER	silent_mutation	Average:48.448; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0724018707	C -> T	LOC_Os07g40020.1	downstream_gene_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:48.448; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0724018707	C -> T	LOC_Os07g40020-LOC_Os07g40030	intergenic_region ; MODIFIER	silent_mutation	Average:48.448; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724018707	9.77E-07	4.25E-12	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724018707	NA	3.67E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	8.59E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	6.94E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	4.29E-06	1.22E-07	mr1143	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	1.31E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	4.41E-06	mr1535	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	5.89E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	7.74E-06	mr1675	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	6.57E-10	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	2.42E-06	5.71E-08	mr1995	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	1.13E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	2.78E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	1.80E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	9.89E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724018707	NA	2.58E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251