\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724012275:

Variant ID: vg0724012275 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24012275
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTTTTAATAGGTATAGGTGCTGATTTTATGAGTGTTGGTACCGGTTATTGAAAAACCGATATTTATAAAACTTAATAGGTGCCGGTTTTAAGTAAATA[C/A]
CCGACACATTCTAATTTATAGGTGCTGGGTGGATAGCATAACCGGCACAGTTCGGATTTATAGGTGATGGTTGTAGTATAATAACCGGTACTTATAGTTT

Reverse complement sequence

AAACTATAAGTACCGGTTATTATACTACAACCATCACCTATAAATCCGAACTGTGCCGGTTATGCTATCCACCCAGCACCTATAAATTAGAATGTGTCGG[G/T]
TATTTACTTAAAACCGGCACCTATTAAGTTTTATAAATATCGGTTTTTCAATAACCGGTACCAACACTCATAAAATCAGCACCTATACCTATTAAAACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.50% 0.04% 0.00% NA
All Indica  2759 92.00% 8.00% 0.04% 0.00% NA
All Japonica  1512 2.70% 97.30% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 88.20% 11.80% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 87.50% 12.50% 0.00% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724012275 C -> A LOC_Os07g40020.1 upstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:40.761; most accessible tissue: Callus, score: 74.623 N N N N
vg0724012275 C -> A LOC_Os07g40000-LOC_Os07g40020 intergenic_region ; MODIFIER silent_mutation Average:40.761; most accessible tissue: Callus, score: 74.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724012275 NA 3.47E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724012275 NA 2.47E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.90E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 6.91E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 7.48E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 2.19E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.93E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.80E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 2.96E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 6.45E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 2.04E-07 2.29E-13 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 6.28E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 6.98E-06 7.20E-10 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 9.89E-07 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 3.77E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 8.15E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 2.31E-10 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.02E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 5.91E-12 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 2.93E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.54E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 3.63E-06 1.12E-11 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724012275 NA 1.36E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251