\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723991314:

Variant ID: vg0723991314 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23991314
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.15, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGAGTCCCTTAACTATACAAAACCAGTCACCCGAGGTCCTTCGGTGGTTTTGACCCGGTTTTGGTCTACGTGGCGCTGAGTCAGCGTGGGACCCACGT[A/G]
AGCCCCACATGTCAGCCTGTCCACGTCAGTTCCTCTCTCTTTCCCCTCCTCTCCCTTCCTCTTCTCTTTCTCACTCTTCTCTCTGGTGCTGTGGGTAGGC

Reverse complement sequence

GCCTACCCACAGCACCAGAGAGAAGAGTGAGAAAGAGAAGAGGAAGGGAGAGGAGGGGAAAGAGAGAGGAACTGACGTGGACAGGCTGACATGTGGGGCT[T/C]
ACGTGGGTCCCACGCTGACTCAGCGCCACGTAGACCAAAACCGGGTCAAAACCACCGAAGGACCTCGGGTGACTGGTTTTGTATAGTTAAGGGACTCCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 41.70% 7.79% 1.90% NA
All Indica  2759 73.30% 10.50% 13.12% 3.04% NA
All Japonica  1512 0.50% 99.20% 0.13% 0.20% NA
Aus  269 88.10% 11.50% 0.37% 0.00% NA
Indica I  595 88.20% 6.90% 4.20% 0.67% NA
Indica II  465 69.90% 12.70% 12.47% 4.95% NA
Indica III  913 74.00% 8.70% 15.01% 2.30% NA
Indica Intermediate  786 63.20% 14.10% 18.07% 4.58% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 0.20% 99.40% 0.40% 0.00% NA
Japonica Intermediate  241 1.20% 97.90% 0.00% 0.83% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 28.90% 65.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723991314 A -> DEL N N silent_mutation Average:96.044; most accessible tissue: Zhenshan97 panicle, score: 99.493 N N N N
vg0723991314 A -> G LOC_Os07g39990.1 upstream_gene_variant ; 345.0bp to feature; MODIFIER silent_mutation Average:96.044; most accessible tissue: Zhenshan97 panicle, score: 99.493 N N N N
vg0723991314 A -> G LOC_Os07g39980.1 downstream_gene_variant ; 1358.0bp to feature; MODIFIER silent_mutation Average:96.044; most accessible tissue: Zhenshan97 panicle, score: 99.493 N N N N
vg0723991314 A -> G LOC_Os07g39980-LOC_Os07g39990 intergenic_region ; MODIFIER silent_mutation Average:96.044; most accessible tissue: Zhenshan97 panicle, score: 99.493 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723991314 A G 0.02 0.04 0.01 0.03 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723991314 4.15E-06 NA mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 7.49E-08 7.49E-08 mr1175 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 2.81E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 1.81E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 1.34E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 8.45E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 9.68E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 5.78E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 5.65E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 2.62E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 1.53E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 8.62E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 1.64E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 6.34E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 8.45E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 4.82E-10 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 3.88E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 1.83E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723991314 NA 5.09E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251