\
| Variant ID: vg0723950725 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 23950725 |
| Reference Allele: C | Alternative Allele: T,CGTCCA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 108. )
TTAAATAGCTATCTCATTGTCTTAAGACTTTAAAAGACCAAACCTTATCATCCTCGCGTTTCTAATTATATAGTTTTTAAAAGTCACACCATTTGCTACC[C/T,CGTCCA]
CTTATGTCATCTCATTCTTTATTTGCTTGCTCGATCTACCACTATTTCTATTCATTCTTCTTGGAACCTTTAAAAATTGGATTTTATAGTTTTTAGAGTT
AACTCTAAAAACTATAAAATCCAATTTTTAAAGGTTCCAAGAAGAATGAATAGAAATAGTGGTAGATCGAGCAAGCAAATAAAGAATGAGATGACATAAG[G/A,TGGACG]
GGTAGCAAATGGTGTGACTTTTAAAAACTATATAATTAGAAACGCGAGGATGATAAGGTTTGGTCTTTTAAAGTCTTAAGACAATGAGATAGCTATTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.30% | 13.70% | 4.21% | 37.60% | CGTCCA: 0.19% |
| All Indica | 2759 | 9.80% | 22.80% | 6.67% | 60.42% | CGTCCA: 0.33% |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 58.00% | 3.00% | 4.46% | 34.57% | NA |
| Indica I | 595 | 8.40% | 6.70% | 6.55% | 78.32% | NA |
| Indica II | 465 | 12.50% | 22.60% | 7.96% | 56.56% | CGTCCA: 0.43% |
| Indica III | 913 | 3.80% | 29.20% | 8.11% | 58.49% | CGTCCA: 0.33% |
| Indica Intermediate | 786 | 16.30% | 27.50% | 4.33% | 51.40% | CGTCCA: 0.51% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 8.90% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723950725 | C -> DEL | N | N | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> CGTCCA | LOC_Os07g39930.1 | upstream_gene_variant ; 2679.0bp to feature; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> CGTCCA | LOC_Os07g39920.1 | downstream_gene_variant ; 262.0bp to feature; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> CGTCCA | LOC_Os07g39920-LOC_Os07g39930 | intergenic_region ; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> T | LOC_Os07g39930.1 | upstream_gene_variant ; 2680.0bp to feature; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> T | LOC_Os07g39920.1 | downstream_gene_variant ; 261.0bp to feature; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0723950725 | C -> T | LOC_Os07g39920-LOC_Os07g39930 | intergenic_region ; MODIFIER | silent_mutation | Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723950725 | NA | 5.31E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 3.15E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 4.42E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 1.20E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | 2.62E-07 | 3.33E-12 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | 1.44E-06 | 3.60E-09 | mr1170_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 2.86E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 1.48E-09 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 7.02E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 3.41E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 7.90E-07 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 6.63E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 4.16E-06 | mr1607_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 3.84E-06 | mr1702_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 2.77E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 6.26E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723950725 | NA | 1.20E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |