\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723950725:

Variant ID: vg0723950725 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 23950725
Reference Allele: CAlternative Allele: T,CGTCCA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAATAGCTATCTCATTGTCTTAAGACTTTAAAAGACCAAACCTTATCATCCTCGCGTTTCTAATTATATAGTTTTTAAAAGTCACACCATTTGCTACC[C/T,CGTCCA]
CTTATGTCATCTCATTCTTTATTTGCTTGCTCGATCTACCACTATTTCTATTCATTCTTCTTGGAACCTTTAAAAATTGGATTTTATAGTTTTTAGAGTT

Reverse complement sequence

AACTCTAAAAACTATAAAATCCAATTTTTAAAGGTTCCAAGAAGAATGAATAGAAATAGTGGTAGATCGAGCAAGCAAATAAAGAATGAGATGACATAAG[G/A,TGGACG]
GGTAGCAAATGGTGTGACTTTTAAAAACTATATAATTAGAAACGCGAGGATGATAAGGTTTGGTCTTTTAAAGTCTTAAGACAATGAGATAGCTATTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.30% 13.70% 4.21% 37.60% CGTCCA: 0.19%
All Indica  2759 9.80% 22.80% 6.67% 60.42% CGTCCA: 0.33%
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 58.00% 3.00% 4.46% 34.57% NA
Indica I  595 8.40% 6.70% 6.55% 78.32% NA
Indica II  465 12.50% 22.60% 7.96% 56.56% CGTCCA: 0.43%
Indica III  913 3.80% 29.20% 8.11% 58.49% CGTCCA: 0.33%
Indica Intermediate  786 16.30% 27.50% 4.33% 51.40% CGTCCA: 0.51%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 8.90% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723950725 C -> DEL N N silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> CGTCCA LOC_Os07g39930.1 upstream_gene_variant ; 2679.0bp to feature; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> CGTCCA LOC_Os07g39920.1 downstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> CGTCCA LOC_Os07g39920-LOC_Os07g39930 intergenic_region ; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> T LOC_Os07g39930.1 upstream_gene_variant ; 2680.0bp to feature; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> T LOC_Os07g39920.1 downstream_gene_variant ; 261.0bp to feature; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0723950725 C -> T LOC_Os07g39920-LOC_Os07g39930 intergenic_region ; MODIFIER silent_mutation Average:33.377; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723950725 NA 5.31E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 3.15E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 4.42E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 1.20E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 2.62E-07 3.33E-12 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 1.44E-06 3.60E-09 mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 2.86E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 1.48E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 7.02E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 3.41E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 7.90E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 6.63E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 4.16E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 3.84E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 2.77E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 6.26E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723950725 NA 1.20E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251