Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723831791:

Variant ID: vg0723831791 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23831791
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCTGTGCATGATTGATTGAATATAGAACACCAGTGCTTGGGGTTGCGAGACCCAAGCGCCAGTTCGCTCGGAAGTCCCCCCTCTCCACCACTAGGCCT[A/G]
GACCTCCTTTTATACCTCAAGGGGTTACCACATGGGCCTAACAACCTAACCTAACTCCGGTGGAGAAGTATTATAATTTTTGCATTAAATGCATGTCTTG

Reverse complement sequence

CAAGACATGCATTTAATGCAAAAATTATAATACTTCTCCACCGGAGTTAGGTTAGGTTGTTAGGCCCATGTGGTAACCCCTTGAGGTATAAAAGGAGGTC[T/C]
AGGCCTAGTGGTGGAGAGGGGGGACTTCCGAGCGAACTGGCGCTTGGGTCTCGCAACCCCAAGCACTGGTGTTCTATATTCAATCAATCATGCACAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	10.40%	1.48%	0.00%	NA
All Indica	2759	98.40%	0.80%	0.76%	0.00%	NA
All Japonica	1512	67.10%	29.80%	3.11%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.20%	0.80%	1.01%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	1.50%	1.91%	0.00%	NA
Temperate Japonica	767	41.90%	52.90%	5.22%	0.00%	NA
Tropical Japonica	504	94.20%	5.40%	0.40%	0.00%	NA
Japonica Intermediate	241	90.50%	7.50%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723831791	A -> G	LOC_Os07g39780.1	upstream_gene_variant ; 1564.0bp to feature; MODIFIER	silent_mutation	Average:50.92; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0723831791	A -> G	LOC_Os07g39780.2	upstream_gene_variant ; 1501.0bp to feature; MODIFIER	silent_mutation	Average:50.92; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0723831791	A -> G	LOC_Os07g39780.3	upstream_gene_variant ; 1501.0bp to feature; MODIFIER	silent_mutation	Average:50.92; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0723831791	A -> G	LOC_Os07g39770.1	downstream_gene_variant ; 4488.0bp to feature; MODIFIER	silent_mutation	Average:50.92; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0723831791	A -> G	LOC_Os07g39770-LOC_Os07g39780	intergenic_region ; MODIFIER	silent_mutation	Average:50.92; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723831791	8.33E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	3.43E-07	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	NA	4.26E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	1.52E-06	1.52E-06	mr1703	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	1.75E-06	1.75E-06	mr1899	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	3.05E-07	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	1.12E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	NA	9.11E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	3.55E-06	3.00E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723831791	NA	6.78E-08	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251