\
| Variant ID: vg0723741534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23741534 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCAAAAAAAAAAGGTCAGCTCGATCTTTAGTCCCGGTTGGTAGATGGCTCAGCCGGTCACGTGGCTGAGCCATCTTTAGTCCCGGTTGGTGTGGTGTTA[C/T]
CAACCGAGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAGATAGCGATCTTTAGTCCTGGATTGGTAGTCCTGGTTTTCAAACCAG
CTGGTTTGAAAACCAGGACTACCAATCCAGGACTAAAGATCGCTATCTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCTCGGTTG[G/A]
TAACACCACACCAACCGGGACTAAAGATGGCTCAGCCACGTGACCGGCTGAGCCATCTACCAACCGGGACTAAAGATCGAGCTGACCTTTTTTTTTTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 10.70% | 1.38% | 0.00% | NA |
| All Indica | 2759 | 95.30% | 3.80% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 72.10% | 25.50% | 2.38% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 3.20% | 1.18% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 7.30% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 82.50% | 14.10% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 55.40% | 42.70% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 26.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723741534 | C -> T | LOC_Os07g39620.1 | upstream_gene_variant ; 4922.0bp to feature; MODIFIER | silent_mutation | Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0723741534 | C -> T | LOC_Os07g39610.1 | downstream_gene_variant ; 545.0bp to feature; MODIFIER | silent_mutation | Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0723741534 | C -> T | LOC_Os07g39610-LOC_Os07g39620 | intergenic_region ; MODIFIER | silent_mutation | Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723741534 | NA | 4.90E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 1.29E-06 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 5.14E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 4.82E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 8.93E-07 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 8.73E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | NA | 2.89E-13 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723741534 | 3.68E-06 | 1.42E-10 | mr1980_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |