\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723741534:

Variant ID: vg0723741534 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23741534
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAAAAAAAAAAGGTCAGCTCGATCTTTAGTCCCGGTTGGTAGATGGCTCAGCCGGTCACGTGGCTGAGCCATCTTTAGTCCCGGTTGGTGTGGTGTTA[C/T]
CAACCGAGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAGATAGCGATCTTTAGTCCTGGATTGGTAGTCCTGGTTTTCAAACCAG

Reverse complement sequence

CTGGTTTGAAAACCAGGACTACCAATCCAGGACTAAAGATCGCTATCTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCTCGGTTG[G/A]
TAACACCACACCAACCGGGACTAAAGATGGCTCAGCCACGTGACCGGCTGAGCCATCTACCAACCGGGACTAAAGATCGAGCTGACCTTTTTTTTTTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.70% 1.38% 0.00% NA
All Indica  2759 95.30% 3.80% 0.94% 0.00% NA
All Japonica  1512 72.10% 25.50% 2.38% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.60% 3.20% 1.18% 0.00% NA
Indica II  465 94.60% 5.20% 0.22% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 7.30% 2.16% 0.00% NA
Temperate Japonica  767 82.50% 14.10% 3.39% 0.00% NA
Tropical Japonica  504 55.40% 42.70% 1.98% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723741534 C -> T LOC_Os07g39620.1 upstream_gene_variant ; 4922.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0723741534 C -> T LOC_Os07g39610.1 downstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0723741534 C -> T LOC_Os07g39610-LOC_Os07g39620 intergenic_region ; MODIFIER silent_mutation Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723741534 NA 4.90E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 1.29E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 5.14E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 4.82E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 8.93E-07 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 8.73E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 NA 2.89E-13 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534 3.68E-06 1.42E-10 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251