\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723711493:

Variant ID: vg0723711493 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23711493
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTAAAAAATAATCAGGATTGTTAGAATACGGCTGTGTTTAGTTCACATTAAAATTGGAAGTTTGGTTAAAATTAGAAGGATGTGATAGAAAAGTT[G/A]
GAAGTTTGAAGAAAAACTTTGAAGCTAAACACGGCGTACATTGAAAAGTAGAAGGTGACGTGCCATCCATGGAGCCACCTTGGTTGGAGCCTTTTCCACT

Reverse complement sequence

AGTGGAAAAGGCTCCAACCAAGGTGGCTCCATGGATGGCACGTCACCTTCTACTTTTCAATGTACGCCGTGTTTAGCTTCAAAGTTTTTCTTCAAACTTC[C/T]
AACTTTTCTATCACATCCTTCTAATTTTAACCAAACTTCCAATTTTAATGTGAACTAAACACAGCCGTATTCTAACAATCCTGATTATTTTTTAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.70% 0.30% 0.00% NA
All Indica  2759 76.30% 23.60% 0.18% 0.00% NA
All Japonica  1512 3.70% 95.70% 0.60% 0.00% NA
Aus  269 42.00% 58.00% 0.00% 0.00% NA
Indica I  595 92.40% 7.20% 0.34% 0.00% NA
Indica II  465 70.50% 29.20% 0.22% 0.00% NA
Indica III  913 78.30% 21.70% 0.00% 0.00% NA
Indica Intermediate  786 65.00% 34.70% 0.25% 0.00% NA
Temperate Japonica  767 6.40% 92.40% 1.17% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723711493 G -> A LOC_Os07g39560.1 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:71.486; most accessible tissue: Callus, score: 84.569 N N N N
vg0723711493 G -> A LOC_Os07g39570.1 downstream_gene_variant ; 3342.0bp to feature; MODIFIER silent_mutation Average:71.486; most accessible tissue: Callus, score: 84.569 N N N N
vg0723711493 G -> A LOC_Os07g39560.3 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:71.486; most accessible tissue: Callus, score: 84.569 N N N N
vg0723711493 G -> A LOC_Os07g39560.2 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:71.486; most accessible tissue: Callus, score: 84.569 N N N N
vg0723711493 G -> A LOC_Os07g39560-LOC_Os07g39570 intergenic_region ; MODIFIER silent_mutation Average:71.486; most accessible tissue: Callus, score: 84.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723711493 NA 8.03E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 8.50E-06 8.50E-06 mr1175 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 7.63E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 8.23E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 9.77E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 1.13E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 4.59E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 1.33E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 2.70E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 3.16E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 1.69E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 8.19E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 7.25E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 6.20E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 3.20E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 4.86E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 2.64E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 2.56E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 9.26E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 6.17E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 8.50E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 5.34E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 7.95E-06 mr1752_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 7.71E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 5.70E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 2.21E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 1.75E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 4.72E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 2.25E-06 2.25E-06 mr1967_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723711493 NA 9.33E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251