\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723699536:

Variant ID: vg0723699536 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23699536
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGTGTGTTGTACTAATGTGCGAGTAGCGAGCTGGGAGGCAGAGAATTGCGCATCCAGGAGGATGGGTGGAATCACGTGATGTCATGAGTGACCAATTC[G/A]
CGAGCTTCGGGGAGCTCAAATTTTGACTTTTTGAGAAGCATATGGTGAAAATGTAGAAGAGCTGGATTTCTCAACTTCTGTTCTTTTGTTAATTTTTTGT

Reverse complement sequence

ACAAAAAATTAACAAAAGAACAGAAGTTGAGAAATCCAGCTCTTCTACATTTTCACCATATGCTTCTCAAAAAGTCAAAATTTGAGCTCCCCGAAGCTCG[C/T]
GAATTGGTCACTCATGACATCACGTGATTCCACCCATCCTCCTGGATGCGCAATTCTCTGCCTCCCAGCTCGCTACTCGCACATTAGTACAACACACCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.30% 0.57% 0.00% NA
All Indica  2759 96.80% 2.20% 0.94% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 2.40% 1.68% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 5.90% 2.04% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723699536 G -> A LOC_Os07g39560.1 upstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:50.134; most accessible tissue: Callus, score: 69.008 N N N N
vg0723699536 G -> A LOC_Os07g39560.3 upstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:50.134; most accessible tissue: Callus, score: 69.008 N N N N
vg0723699536 G -> A LOC_Os07g39550.1 downstream_gene_variant ; 3998.0bp to feature; MODIFIER silent_mutation Average:50.134; most accessible tissue: Callus, score: 69.008 N N N N
vg0723699536 G -> A LOC_Os07g39550-LOC_Os07g39560 intergenic_region ; MODIFIER silent_mutation Average:50.134; most accessible tissue: Callus, score: 69.008 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723699536 NA 1.30E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723699536 NA 1.22E-08 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723699536 NA 6.95E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723699536 NA 8.46E-15 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723699536 4.57E-06 1.07E-10 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251