\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723648372:

Variant ID: vg0723648372 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23648372
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTAGATCAATTGATATAGTTATATAAATGAGCATGTTCGGCTAACCATTACAGCCGCTACAGCTAAACACAACCCTAGCTGCTATAGATGCAGACACC[G/A]
GGGGCGGATCTAGGAACAAAAAATTGAGAGGCTCAATTATACAGTTTCTTCAACCTCCAGCCATTTAGAGACCTTTAGTTTATTATTCATGGTGAAAAAA

Reverse complement sequence

TTTTTTCACCATGAATAATAAACTAAAGGTCTCTAAATGGCTGGAGGTTGAAGAAACTGTATAATTGAGCCTCTCAATTTTTTGTTCCTAGATCCGCCCC[C/T]
GGTGTCTGCATCTATAGCAGCTAGGGTTGTGTTTAGCTGTAGCGGCTGTAATGGTTAGCCGAACATGCTCATTTATATAACTATATCAATTGATCTAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.30% 0.06% 0.36% NA
All Indica  2759 92.60% 6.90% 0.11% 0.40% NA
All Japonica  1512 22.90% 77.10% 0.00% 0.07% NA
Aus  269 42.80% 57.20% 0.00% 0.00% NA
Indica I  595 95.10% 4.50% 0.00% 0.34% NA
Indica II  465 90.10% 9.20% 0.00% 0.65% NA
Indica III  913 98.40% 1.30% 0.00% 0.33% NA
Indica Intermediate  786 85.50% 13.70% 0.38% 0.38% NA
Temperate Japonica  767 10.00% 89.80% 0.00% 0.13% NA
Tropical Japonica  504 30.40% 69.60% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 51.10% 43.30% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723648372 G -> DEL N N silent_mutation Average:85.714; most accessible tissue: Zhenshan97 flag leaf, score: 93.657 N N N N
vg0723648372 G -> A LOC_Os07g39470.1 upstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:85.714; most accessible tissue: Zhenshan97 flag leaf, score: 93.657 N N N N
vg0723648372 G -> A LOC_Os07g39460-LOC_Os07g39470 intergenic_region ; MODIFIER silent_mutation Average:85.714; most accessible tissue: Zhenshan97 flag leaf, score: 93.657 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723648372 G A -0.01 -0.01 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723648372 NA 7.04E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 1.17E-07 1.85E-07 mr1563 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 NA 1.70E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 NA 7.83E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 NA 5.11E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 3.44E-07 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 9.28E-07 5.66E-07 mr1563_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 NA 7.68E-08 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723648372 NA 1.26E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251