\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723603381:

Variant ID: vg0723603381 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23603381
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAATCTATATACTACCAAATATGATGGCTAGCCCACGTAAATGCATAACCAGGTTTTCTAGGTCTTTGATAGGCCAATCCAGAATATGCGGTTACATG[A/C]
AGTGATGTAATGCAAGACAACTAGTGAATGTTCGCTCTCGGATCAGGAAAATCAATCTCTGCGTCACTGTTATTCTAAACCTGACATTAGTTAGTCAGCA

Reverse complement sequence

TGCTGACTAACTAATGTCAGGTTTAGAATAACAGTGACGCAGAGATTGATTTTCCTGATCCGAGAGCGAACATTCACTAGTTGTCTTGCATTACATCACT[T/G]
CATGTAACCGCATATTCTGGATTGGCCTATCAAAGACCTAGAAAACCTGGTTATGCATTTACGTGGGCTAGCCATCATATTTGGTAGTATATAGATTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 29.90% 0.00% 0.34% NA
All Indica  2759 94.00% 5.60% 0.00% 0.36% NA
All Japonica  1512 20.80% 79.10% 0.00% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.00% 0.17% NA
Indica II  465 90.10% 9.20% 0.00% 0.65% NA
Indica III  913 98.50% 1.20% 0.00% 0.33% NA
Indica Intermediate  786 89.90% 9.70% 0.00% 0.38% NA
Temperate Japonica  767 9.80% 90.10% 0.00% 0.13% NA
Tropical Japonica  504 29.60% 70.40% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 57.80% 36.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723603381 A -> DEL N N silent_mutation Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0723603381 A -> C LOC_Os07g39410.1 upstream_gene_variant ; 2560.0bp to feature; MODIFIER silent_mutation Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0723603381 A -> C LOC_Os07g39400.1 intron_variant ; MODIFIER silent_mutation Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723603381 NA 1.78E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 4.80E-06 2.71E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 2.01E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 2.06E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 4.10E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 8.24E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 1.91E-06 1.84E-12 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 3.92E-08 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 1.43E-06 6.56E-07 mr1563_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 4.86E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 NA 2.75E-08 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381 5.23E-06 5.64E-09 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251