\
| Variant ID: vg0723603381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23603381 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
AGTAATCTATATACTACCAAATATGATGGCTAGCCCACGTAAATGCATAACCAGGTTTTCTAGGTCTTTGATAGGCCAATCCAGAATATGCGGTTACATG[A/C]
AGTGATGTAATGCAAGACAACTAGTGAATGTTCGCTCTCGGATCAGGAAAATCAATCTCTGCGTCACTGTTATTCTAAACCTGACATTAGTTAGTCAGCA
TGCTGACTAACTAATGTCAGGTTTAGAATAACAGTGACGCAGAGATTGATTTTCCTGATCCGAGAGCGAACATTCACTAGTTGTCTTGCATTACATCACT[T/G]
CATGTAACCGCATATTCTGGATTGGCCTATCAAAGACCTAGAAAACCTGGTTATGCATTTACGTGGGCTAGCCATCATATTTGGTAGTATATAGATTACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 29.90% | 0.00% | 0.34% | NA |
| All Indica | 2759 | 94.00% | 5.60% | 0.00% | 0.36% | NA |
| All Japonica | 1512 | 20.80% | 79.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 90.10% | 9.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 98.50% | 1.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 89.90% | 9.70% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 9.80% | 90.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 36.70% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723603381 | A -> DEL | N | N | silent_mutation | Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0723603381 | A -> C | LOC_Os07g39410.1 | upstream_gene_variant ; 2560.0bp to feature; MODIFIER | silent_mutation | Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0723603381 | A -> C | LOC_Os07g39400.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723603381 | NA | 1.78E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | 4.80E-06 | 2.71E-45 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 2.01E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 2.06E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 4.10E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 8.24E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | 1.91E-06 | 1.84E-12 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | 3.92E-08 | NA | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | 1.43E-06 | 6.56E-07 | mr1563_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 4.86E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | NA | 2.75E-08 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723603381 | 5.23E-06 | 5.64E-09 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |