RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0723603381:

Variant ID: vg0723603381 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23603381
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAATCTATATACTACCAAATATGATGGCTAGCCCACGTAAATGCATAACCAGGTTTTCTAGGTCTTTGATAGGCCAATCCAGAATATGCGGTTACATG[A/C]
AGTGATGTAATGCAAGACAACTAGTGAATGTTCGCTCTCGGATCAGGAAAATCAATCTCTGCGTCACTGTTATTCTAAACCTGACATTAGTTAGTCAGCA

Reverse complement sequence

TGCTGACTAACTAATGTCAGGTTTAGAATAACAGTGACGCAGAGATTGATTTTCCTGATCCGAGAGCGAACATTCACTAGTTGTCTTGCATTACATCACT[T/G]
CATGTAACCGCATATTCTGGATTGGCCTATCAAAGACCTAGAAAACCTGGTTATGCATTTACGTGGGCTAGCCATCATATTTGGTAGTATATAGATTACT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	29.90%	0.00%	0.34%	NA
All Indica	2759	94.00%	5.60%	0.00%	0.36%	NA
All Japonica	1512	20.80%	79.10%	0.00%	0.07%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.17%	NA
Indica II	465	90.10%	9.20%	0.00%	0.65%	NA
Indica III	913	98.50%	1.20%	0.00%	0.33%	NA
Indica Intermediate	786	89.90%	9.70%	0.00%	0.38%	NA
Temperate Japonica	767	9.80%	90.10%	0.00%	0.13%	NA
Tropical Japonica	504	29.60%	70.40%	0.00%	0.00%	NA
Japonica Intermediate	241	37.80%	62.20%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	36.70%	0.00%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723603381	A -> DEL	N	N	silent_mutation	Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0723603381	A -> C	LOC_Os07g39410.1	upstream_gene_variant ; 2560.0bp to feature; MODIFIER	silent_mutation	Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0723603381	A -> C	LOC_Os07g39400.1	intron_variant ; MODIFIER	silent_mutation	Average:59.648; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723603381	NA	1.78E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	4.80E-06	2.71E-45	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	NA	2.01E-07	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	NA	2.06E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	NA	4.10E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	NA	8.24E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	1.91E-06	1.84E-12	mr1533_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	3.92E-08	NA	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	1.43E-06	6.56E-07	mr1563_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723603381	NA	4.86E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 12 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0723603381:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact