\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723580060:

Variant ID: vg0723580060 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23580060
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GTATAGTGGCCGCTGCTTGTGAATTTCCAAACAATCTGATCCGGCTCTTCGCTGTCTAAGTGCACATTCCATACCGCCTCCCACAGGCAGACTAGCTGAT[T/C]
GAGAAGGTTGATTGTGATAGATGAATCCGCATCGAGGGTCAGGTCATGCACCTAGGAGTCGTCTTCTTTCCTTTGGCGTAGGGATTTCTTCCTATTTTTG

Reverse complement sequence

CAAAAATAGGAAGAAATCCCTACGCCAAAGGAAAGAAGACGACTCCTAGGTGCATGACCTGACCCTCGATGCGGATTCATCTATCACAATCAACCTTCTC[A/G]
ATCAGCTAGTCTGCCTGTGGGAGGCGGTATGGAATGTGCACTTAGACAGCGAAGAGCCGGATCAGATTGTTTGGAAATTCACAAGCAGCGGCCACTATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 42.70% 0.36% 0.19% NA
All Indica  2759 86.20% 13.30% 0.36% 0.22% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 93.90% 5.50% 0.50% 0.00% NA
Indica II  465 86.50% 12.90% 0.00% 0.65% NA
Indica III  913 85.80% 13.60% 0.44% 0.22% NA
Indica Intermediate  786 80.50% 19.00% 0.38% 0.13% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 31.10% 58.90% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723580060 T -> DEL N N silent_mutation Average:53.742; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0723580060 T -> C LOC_Os07g39350.1 upstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:53.742; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0723580060 T -> C LOC_Os07g39360.1 downstream_gene_variant ; 4608.0bp to feature; MODIFIER silent_mutation Average:53.742; most accessible tissue: Minghui63 root, score: 74.1 N N N N
vg0723580060 T -> C LOC_Os07g39340-LOC_Os07g39350 intergenic_region ; MODIFIER silent_mutation Average:53.742; most accessible tissue: Minghui63 root, score: 74.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723580060 NA 3.54E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.82E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 3.13E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 9.11E-32 mr1074_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 3.27E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 8.00E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.20E-19 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 5.99E-17 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 8.35E-33 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.36E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 7.51E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.03E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 8.35E-24 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 3.44E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 1.10E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 2.47E-24 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 1.64E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.42E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 2.63E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 8.87E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723580060 NA 4.85E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251