\
| Variant ID: vg0723547698 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23547698 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, A: 0.48, others allele: 0.00, population size: 94. )
AAGTAACATCCCAAAACATTCACATCACAAATCTTAAGTTACTTGTACACACAAATCAAATACATCACAAATCTTAAAAAAATTACACACAAACCAAATA[A/C]
ATCACATATTATACATCTCAGATCCATACAACAAATCACAAAATTATACGTCTAAGTGAATCACAAATTCTAAAAAAAAAAGAAAAAAAGAATGGATGCC
GGCATCCATTCTTTTTTTCTTTTTTTTTTAGAATTTGTGATTCACTTAGACGTATAATTTTGTGATTTGTTGTATGGATCTGAGATGTATAATATGTGAT[T/G]
TATTTGGTTTGTGTGTAATTTTTTTAAGATTTGTGATGTATTTGATTTGTGTGTACAAGTAACTTAAGATTTGTGATGTGAATGTTTTGGGATGTTACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 35.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 89.30% | 10.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 16.60% | 83.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.60% | 10.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 86.30% | 13.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 11.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 8.20% | 91.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 27.60% | 72.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 53.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723547698 | A -> C | LOC_Os07g39310.1 | downstream_gene_variant ; 3623.0bp to feature; MODIFIER | silent_mutation | Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0723547698 | A -> C | LOC_Os07g39310-LOC_Os07g39320 | intergenic_region ; MODIFIER | silent_mutation | Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723547698 | NA | 8.29E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | NA | 1.03E-27 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 8.46E-06 | 8.46E-06 | mr1162_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 2.27E-06 | 2.27E-06 | mr1542_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 4.65E-11 | NA | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 2.12E-06 | 1.52E-06 | mr1563_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 1.81E-06 | 1.29E-07 | mr1563_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | 7.16E-06 | NA | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723547698 | NA | 1.98E-08 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |