\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723547698:

Variant ID: vg0723547698 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23547698
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, A: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAACATCCCAAAACATTCACATCACAAATCTTAAGTTACTTGTACACACAAATCAAATACATCACAAATCTTAAAAAAATTACACACAAACCAAATA[A/C]
ATCACATATTATACATCTCAGATCCATACAACAAATCACAAAATTATACGTCTAAGTGAATCACAAATTCTAAAAAAAAAAGAAAAAAAGAATGGATGCC

Reverse complement sequence

GGCATCCATTCTTTTTTTCTTTTTTTTTTAGAATTTGTGATTCACTTAGACGTATAATTTTGTGATTTGTTGTATGGATCTGAGATGTATAATATGTGAT[T/G]
TATTTGGTTTGTGTGTAATTTTTTTAAGATTTGTGATGTATTTGATTTGTGTGTACAAGTAACTTAAGATTTGTGATGTGAATGTTTTGGGATGTTACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 35.70% 0.32% 0.00% NA
All Indica  2759 89.30% 10.30% 0.36% 0.00% NA
All Japonica  1512 16.60% 83.30% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.70% 0.17% 0.00% NA
Indica II  465 88.60% 10.80% 0.65% 0.00% NA
Indica III  913 86.30% 13.50% 0.22% 0.00% NA
Indica Intermediate  786 88.20% 11.30% 0.51% 0.00% NA
Temperate Japonica  767 8.20% 91.70% 0.13% 0.00% NA
Tropical Japonica  504 27.60% 72.40% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 43.30% 53.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723547698 A -> C LOC_Os07g39310.1 downstream_gene_variant ; 3623.0bp to feature; MODIFIER silent_mutation Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0723547698 A -> C LOC_Os07g39310-LOC_Os07g39320 intergenic_region ; MODIFIER silent_mutation Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723547698 NA 8.29E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 NA 1.03E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 8.46E-06 8.46E-06 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 2.27E-06 2.27E-06 mr1542_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 4.65E-11 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 2.12E-06 1.52E-06 mr1563_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 1.81E-06 1.29E-07 mr1563_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 7.16E-06 NA mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698 NA 1.98E-08 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251