Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723547698:

Variant ID: vg0723547698 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23547698
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, A: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTAACATCCCAAAACATTCACATCACAAATCTTAAGTTACTTGTACACACAAATCAAATACATCACAAATCTTAAAAAAATTACACACAAACCAAATA[A/C]
ATCACATATTATACATCTCAGATCCATACAACAAATCACAAAATTATACGTCTAAGTGAATCACAAATTCTAAAAAAAAAAGAAAAAAAGAATGGATGCC

Reverse complement sequence

GGCATCCATTCTTTTTTTCTTTTTTTTTTAGAATTTGTGATTCACTTAGACGTATAATTTTGTGATTTGTTGTATGGATCTGAGATGTATAATATGTGAT[T/G]
TATTTGGTTTGTGTGTAATTTTTTTAAGATTTGTGATGTATTTGATTTGTGTGTACAAGTAACTTAAGATTTGTGATGTGAATGTTTTGGGATGTTACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	35.70%	0.32%	0.00%	NA
All Indica	2759	89.30%	10.30%	0.36%	0.00%	NA
All Japonica	1512	16.60%	83.30%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	96.10%	3.70%	0.17%	0.00%	NA
Indica II	465	88.60%	10.80%	0.65%	0.00%	NA
Indica III	913	86.30%	13.50%	0.22%	0.00%	NA
Indica Intermediate	786	88.20%	11.30%	0.51%	0.00%	NA
Temperate Japonica	767	8.20%	91.70%	0.13%	0.00%	NA
Tropical Japonica	504	27.60%	72.40%	0.00%	0.00%	NA
Japonica Intermediate	241	20.30%	79.70%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	1.04%	0.00%	NA
Intermediate	90	43.30%	53.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723547698	A -> C	LOC_Os07g39310.1	downstream_gene_variant ; 3623.0bp to feature; MODIFIER	silent_mutation	Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0723547698	A -> C	LOC_Os07g39310-LOC_Os07g39320	intergenic_region ; MODIFIER	silent_mutation	Average:46.151; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723547698	NA	8.29E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	NA	1.03E-27	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	8.46E-06	8.46E-06	mr1162_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	2.27E-06	2.27E-06	mr1542_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	4.65E-11	NA	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	2.12E-06	1.52E-06	mr1563_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	1.81E-06	1.29E-07	mr1563_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	7.16E-06	NA	mr1758_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723547698	NA	1.98E-08	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251