\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723509971:

Variant ID: vg0723509971 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 23509971
Reference Allele: AAlternative Allele: T,ATT,ATATT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, T: 0.16, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATCATTGATGTTATATGTAAAAAAAAAAGTTAATGGTGTGGCCCAATAGCACAAAACCCCAAACCACTCAAGACAAAATATATATATATATATATAT[A/T,ATT,ATATT]
TTAACTAGAGCTAAGAGAAAGACAAAAAAATATCGAGGGCCAAAACTTCTTATACCGAAGAAATAATGTAAGGGTGCTACACTTTGCAATGTTATTTGTA

Reverse complement sequence

TACAAATAACATTGCAAAGTGTAGCACCCTTACATTATTTCTTCGGTATAAGAAGTTTTGGCCCTCGATATTTTTTTGTCTTTCTCTTAGCTCTAGTTAA[T/A,AAT,AATAT]
ATATATATATATATATATATTTTGTCTTGAGTGGTTTGGGGTTTTGTGCTATTGGGCCACACCATTAACTTTTTTTTTTACATATAACATCAATGATACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 28.90% 8.08% 0.00% ATT: 0.76%; ATATT: 0.04%
All Indica  2759 63.00% 29.90% 7.07% 0.00% ATT: 0.07%
All Japonica  1512 59.10% 28.60% 10.19% 0.00% ATT: 2.05%; ATATT: 0.13%
Aus  269 74.70% 17.80% 7.43% 0.00% NA
Indica I  595 85.00% 3.00% 11.93% 0.00% NA
Indica II  465 74.80% 17.40% 7.53% 0.00% ATT: 0.22%
Indica III  913 39.80% 57.90% 2.30% 0.00% NA
Indica Intermediate  786 66.30% 24.90% 8.65% 0.00% ATT: 0.13%
Temperate Japonica  767 86.80% 7.60% 4.95% 0.00% ATT: 0.65%
Tropical Japonica  504 26.60% 52.80% 16.27% 0.00% ATT: 3.97%; ATATT: 0.40%
Japonica Intermediate  241 38.60% 44.80% 14.11% 0.00% ATT: 2.49%
VI/Aromatic  96 64.60% 33.30% 0.00% 0.00% ATT: 2.08%
Intermediate  90 52.20% 32.20% 14.44% 0.00% ATT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723509971 A -> ATATT LOC_Os07g39270.1 upstream_gene_variant ; 679.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATATT LOC_Os07g39270.2 upstream_gene_variant ; 679.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATATT LOC_Os07g39280.1 downstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATATT LOC_Os07g39270-LOC_Os07g39280 intergenic_region ; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATT LOC_Os07g39270.1 upstream_gene_variant ; 679.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATT LOC_Os07g39270.2 upstream_gene_variant ; 679.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATT LOC_Os07g39280.1 downstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> ATT LOC_Os07g39270-LOC_Os07g39280 intergenic_region ; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> T LOC_Os07g39270.1 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> T LOC_Os07g39270.2 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> T LOC_Os07g39280.1 downstream_gene_variant ; 1928.0bp to feature; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N
vg0723509971 A -> T LOC_Os07g39270-LOC_Os07g39280 intergenic_region ; MODIFIER silent_mutation Average:53.728; most accessible tissue: Callus, score: 77.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723509971 NA 5.87E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723509971 2.55E-06 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723509971 NA 6.91E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723509971 NA 7.15E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723509971 3.95E-06 5.08E-10 mr1865_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251