\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723501936:

Variant ID: vg0723501936 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23501936
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCACGTATTGAACTCTTTTCCAAATACGAATGAGTACCCTGGCATTTCGCTCTTTCTAAATCTCCCATGCGACGAGGATCACCATCGAGTCAAGCA[G/C]
TTTTCTCTGTTCTTTGTGAACCTTCTTCCGGACTTCGTATCACCCAGCAAAAGAGACCATCTCCTGTGAAAACATCACCGTTCCTATCCGTTGGCAGATT

Reverse complement sequence

AATCTGCCAACGGATAGGAACGGTGATGTTTTCACAGGAGATGGTCTCTTTTGCTGGGTGATACGAAGTCCGGAAGAAGGTTCACAAAGAACAGAGAAAA[C/G]
TGCTTGACTCGATGGTGATCCTCGTCGCATGGGAGATTTAGAAAGAGCGAAATGCCAGGGTACTCATTCGTATTTGGAAAAGAGTTCAATACGTGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 28.00% 1.06% 17.75% NA
All Indica  2759 87.00% 4.70% 0.58% 7.72% NA
All Japonica  1512 1.40% 59.10% 1.65% 37.90% NA
Aus  269 23.00% 76.60% 0.37% 0.00% NA
Indica I  595 95.00% 3.90% 0.00% 1.18% NA
Indica II  465 88.00% 3.40% 1.29% 7.31% NA
Indica III  913 86.30% 1.90% 0.77% 11.06% NA
Indica Intermediate  786 81.00% 9.50% 0.38% 9.03% NA
Temperate Japonica  767 0.80% 87.20% 0.13% 11.86% NA
Tropical Japonica  504 2.00% 27.00% 3.57% 67.46% NA
Japonica Intermediate  241 2.10% 36.50% 2.49% 58.92% NA
VI/Aromatic  96 1.00% 64.60% 1.04% 33.33% NA
Intermediate  90 35.60% 33.30% 7.78% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723501936 G -> DEL N N silent_mutation Average:70.392; most accessible tissue: Callus, score: 97.52 N N N N
vg0723501936 G -> C LOC_Os07g39250.1 upstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:70.392; most accessible tissue: Callus, score: 97.52 N N N N
vg0723501936 G -> C LOC_Os07g39260.1 downstream_gene_variant ; 978.0bp to feature; MODIFIER silent_mutation Average:70.392; most accessible tissue: Callus, score: 97.52 N N N N
vg0723501936 G -> C LOC_Os07g39270.1 downstream_gene_variant ; 4916.0bp to feature; MODIFIER silent_mutation Average:70.392; most accessible tissue: Callus, score: 97.52 N N N N
vg0723501936 G -> C LOC_Os07g39250-LOC_Os07g39260 intergenic_region ; MODIFIER silent_mutation Average:70.392; most accessible tissue: Callus, score: 97.52 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723501936 NA 3.37E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723501936 NA 1.59E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723501936 1.97E-06 NA mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723501936 4.86E-10 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723501936 4.66E-06 1.63E-11 mr1563_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251