\
| Variant ID: vg0723474331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23474331 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )
CATCATGAAAATTATATTCACCTATTGCAACGGACATGCATTTTTGCTAGTAAAAAAAAGGCTTGCTTTAAGATTCTTTCACTAGTCATTTAGTTTAATC[A/G]
AAAATTAAAAAAAAAAGCTAGGGGGATCCTATCTTGATCCCTCTAGTCAGGTTGTACATTAGGCGAATTGATTTTATCAAGTACTAGGTGGAAAAAATTG
CAATTTTTTCCACCTAGTACTTGATAAAATCAATTCGCCTAATGTACAACCTGACTAGAGGGATCAAGATAGGATCCCCCTAGCTTTTTTTTTTAATTTT[T/C]
GATTAAACTAAATGACTAGTGAAAGAATCTTAAAGCAAGCCTTTTTTTTACTAGCAAAAATGCATGTCCGTTGCAATAGGTGAATATAATTTTCATGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 15.60% | 5.40% | 7.60% | NA |
| All Indica | 2759 | 90.60% | 2.60% | 1.63% | 5.15% | NA |
| All Japonica | 1512 | 37.00% | 39.60% | 12.50% | 10.91% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.30% | 2.40% | 0.84% | 0.50% | NA |
| Indica II | 465 | 92.00% | 2.60% | 0.43% | 4.95% | NA |
| Indica III | 913 | 87.00% | 3.10% | 1.31% | 8.65% | NA |
| Indica Intermediate | 786 | 89.60% | 2.40% | 3.31% | 4.71% | NA |
| Temperate Japonica | 767 | 13.80% | 56.80% | 20.21% | 9.13% | NA |
| Tropical Japonica | 504 | 63.10% | 18.70% | 3.97% | 14.29% | NA |
| Japonica Intermediate | 241 | 56.40% | 28.20% | 5.81% | 9.54% | NA |
| VI/Aromatic | 96 | 2.10% | 44.80% | 16.67% | 36.46% | NA |
| Intermediate | 90 | 51.10% | 25.60% | 5.56% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723474331 | A -> DEL | N | N | silent_mutation | Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg0723474331 | A -> G | LOC_Os07g39180.1 | upstream_gene_variant ; 2615.0bp to feature; MODIFIER | silent_mutation | Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg0723474331 | A -> G | LOC_Os07g39200.1 | upstream_gene_variant ; 4508.0bp to feature; MODIFIER | silent_mutation | Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg0723474331 | A -> G | LOC_Os07g39190.1 | downstream_gene_variant ; 2965.0bp to feature; MODIFIER | silent_mutation | Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg0723474331 | A -> G | LOC_Os07g39180-LOC_Os07g39190 | intergenic_region ; MODIFIER | silent_mutation | Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723474331 | NA | 2.80E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 1.45E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | 4.05E-17 | 2.66E-59 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | 1.65E-11 | 6.43E-21 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 9.01E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 3.19E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | 5.93E-32 | 7.23E-93 | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | 2.71E-09 | 5.52E-08 | mr1563_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | 8.43E-17 | 1.31E-28 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 1.22E-09 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 3.54E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 3.70E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723474331 | NA | 2.80E-18 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |