\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723474331:

Variant ID: vg0723474331 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23474331
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CATCATGAAAATTATATTCACCTATTGCAACGGACATGCATTTTTGCTAGTAAAAAAAAGGCTTGCTTTAAGATTCTTTCACTAGTCATTTAGTTTAATC[A/G]
AAAATTAAAAAAAAAAGCTAGGGGGATCCTATCTTGATCCCTCTAGTCAGGTTGTACATTAGGCGAATTGATTTTATCAAGTACTAGGTGGAAAAAATTG

Reverse complement sequence

CAATTTTTTCCACCTAGTACTTGATAAAATCAATTCGCCTAATGTACAACCTGACTAGAGGGATCAAGATAGGATCCCCCTAGCTTTTTTTTTTAATTTT[T/C]
GATTAAACTAAATGACTAGTGAAAGAATCTTAAAGCAAGCCTTTTTTTTACTAGCAAAAATGCATGTCCGTTGCAATAGGTGAATATAATTTTCATGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 15.60% 5.40% 7.60% NA
All Indica  2759 90.60% 2.60% 1.63% 5.15% NA
All Japonica  1512 37.00% 39.60% 12.50% 10.91% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 96.30% 2.40% 0.84% 0.50% NA
Indica II  465 92.00% 2.60% 0.43% 4.95% NA
Indica III  913 87.00% 3.10% 1.31% 8.65% NA
Indica Intermediate  786 89.60% 2.40% 3.31% 4.71% NA
Temperate Japonica  767 13.80% 56.80% 20.21% 9.13% NA
Tropical Japonica  504 63.10% 18.70% 3.97% 14.29% NA
Japonica Intermediate  241 56.40% 28.20% 5.81% 9.54% NA
VI/Aromatic  96 2.10% 44.80% 16.67% 36.46% NA
Intermediate  90 51.10% 25.60% 5.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723474331 A -> DEL N N silent_mutation Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg0723474331 A -> G LOC_Os07g39180.1 upstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg0723474331 A -> G LOC_Os07g39200.1 upstream_gene_variant ; 4508.0bp to feature; MODIFIER silent_mutation Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg0723474331 A -> G LOC_Os07g39190.1 downstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg0723474331 A -> G LOC_Os07g39180-LOC_Os07g39190 intergenic_region ; MODIFIER silent_mutation Average:43.774; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723474331 NA 2.80E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 1.45E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 4.05E-17 2.66E-59 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 1.65E-11 6.43E-21 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 9.01E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 3.19E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 5.93E-32 7.23E-93 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 2.71E-09 5.52E-08 mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 8.43E-17 1.31E-28 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 1.22E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 3.54E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 3.70E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723474331 NA 2.80E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251