\
| Variant ID: vg0723457034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23457034 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCAAACCGACGACCATCCATAATGGCATCAATAACATGCCAAGCAACTCCGCGTATGTCATCATTGTTGCCGCATCTTGGGAGGATGGTGGCCCTTACT[C/A]
TGCGGTTGATCACACTTGGGAGAGCCCTCAAACCCGCCACCTTTCCATATGTGTACCCTCCCCCTTCTTCATAAAACTGAGAAAAGTGATCAATGGGGAA
TTCCCCATTGATCACTTTTCTCAGTTTTATGAAGAAGGGGGAGGGTACACATATGGAAAGGTGGCGGGTTTGAGGGCTCTCCCAAGTGTGATCAACCGCA[G/T]
AGTAAGGGCCACCATCCTCCCAAGATGCGGCAACAATGATGACATACGCGGAGTTGCTTGGCATGTTATTGATGCCATTATGGATGGTCGTCGGTTTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.20% | 0.50% | 7.36% | 67.88% | NA |
| All Indica | 2759 | 5.50% | 0.70% | 7.29% | 86.48% | NA |
| All Japonica | 1512 | 58.80% | 0.10% | 0.66% | 40.41% | NA |
| Aus | 269 | 3.30% | 1.10% | 46.84% | 48.70% | NA |
| Indica I | 595 | 5.40% | 0.50% | 2.69% | 91.43% | NA |
| Indica II | 465 | 5.20% | 0.00% | 5.81% | 89.03% | NA |
| Indica III | 913 | 3.30% | 0.70% | 9.20% | 86.86% | NA |
| Indica Intermediate | 786 | 8.50% | 1.30% | 9.41% | 80.79% | NA |
| Temperate Japonica | 767 | 86.40% | 0.00% | 0.13% | 13.43% | NA |
| Tropical Japonica | 504 | 26.80% | 0.40% | 1.59% | 71.23% | NA |
| Japonica Intermediate | 241 | 37.80% | 0.00% | 0.41% | 61.83% | NA |
| VI/Aromatic | 96 | 62.50% | 0.00% | 2.08% | 35.42% | NA |
| Intermediate | 90 | 37.80% | 1.10% | 10.00% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723457034 | C -> DEL | LOC_Os07g39150.1 | N | frameshift_variant | Average:7.312; most accessible tissue: Callus, score: 14.641 | N | N | N | N |
| vg0723457034 | C -> A | LOC_Os07g39150.1 | missense_variant ; p.Arg256Ile; MODERATE | nonsynonymous_codon ; R256I | Average:7.312; most accessible tissue: Callus, score: 14.641 | probably damaging |
-2.21 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723457034 | NA | 2.06E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | 7.65E-13 | 9.99E-64 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 3.23E-12 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 7.20E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 4.13E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 8.41E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 6.23E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 1.01E-06 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | 2.13E-17 | 3.91E-100 | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | 8.38E-07 | 5.21E-17 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 3.23E-06 | mr1827_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723457034 | NA | 1.62E-14 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |