\
| Variant ID: vg0723409844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23409844 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 72. )
GAAATAGAATTGAGATATTAGGTAGACAAATATATCAACCAAACCAGAGCGATCTAAGAGATCGAAGCAATGCAGCCTTGAACAACACTAATGTAGCCGA[T/C]
AGATTCACCAGGGCCAGTGGAACGTAGGACTTACCCCTTCACCGGAGATCGAACTGAACCGATGCAGCCCCGCGTCAGGTGCCATATTCCGCTGGAAGAT
ATCTTCCAGCGGAATATGGCACCTGACGCGGGGCTGCATCGGTTCAGTTCGATCTCCGGTGAAGGGGTAAGTCCTACGTTCCACTGGCCCTGGTGAATCT[A/G]
TCGGCTACATTAGTGTTGTTCAAGGCTGCATTGCTTCGATCTCTTAGATCGCTCTGGTTTGGTTGATATATTTGTCTACCTAATATCTCAATTCTATTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 23.60% | 0.13% | 0.04% | NA |
| All Indica | 2759 | 94.30% | 5.40% | 0.22% | 0.07% | NA |
| All Japonica | 1512 | 42.00% | 58.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 3.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.60% | 6.90% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723409844 | T -> DEL | N | N | silent_mutation | Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0723409844 | T -> C | LOC_Os07g39040.1 | upstream_gene_variant ; 1304.0bp to feature; MODIFIER | silent_mutation | Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0723409844 | T -> C | LOC_Os07g39040-LOC_Os07g39060 | intergenic_region ; MODIFIER | silent_mutation | Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723409844 | 1.25E-20 | 5.59E-66 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | 1.02E-12 | 3.44E-22 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | NA | 5.83E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | 1.01E-06 | 1.01E-06 | mr1866 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | NA | 4.90E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | 3.91E-34 | 2.66E-99 | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | 8.89E-09 | 1.41E-08 | mr1563_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | 3.42E-20 | 1.71E-31 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | NA | 7.41E-08 | mr1599_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | NA | 3.41E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723409844 | NA | 9.25E-16 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |