\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723409844:

Variant ID: vg0723409844 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23409844
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATAGAATTGAGATATTAGGTAGACAAATATATCAACCAAACCAGAGCGATCTAAGAGATCGAAGCAATGCAGCCTTGAACAACACTAATGTAGCCGA[T/C]
AGATTCACCAGGGCCAGTGGAACGTAGGACTTACCCCTTCACCGGAGATCGAACTGAACCGATGCAGCCCCGCGTCAGGTGCCATATTCCGCTGGAAGAT

Reverse complement sequence

ATCTTCCAGCGGAATATGGCACCTGACGCGGGGCTGCATCGGTTCAGTTCGATCTCCGGTGAAGGGGTAAGTCCTACGTTCCACTGGCCCTGGTGAATCT[A/G]
TCGGCTACATTAGTGTTGTTCAAGGCTGCATTGCTTCGATCTCTTAGATCGCTCTGGTTTGGTTGATATATTTGTCTACCTAATATCTCAATTCTATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 23.60% 0.13% 0.04% NA
All Indica  2759 94.30% 5.40% 0.22% 0.07% NA
All Japonica  1512 42.00% 58.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 95.80% 3.90% 0.34% 0.00% NA
Indica II  465 87.50% 12.30% 0.22% 0.00% NA
Indica III  913 98.20% 1.60% 0.00% 0.11% NA
Indica Intermediate  786 92.60% 6.90% 0.38% 0.13% NA
Temperate Japonica  767 14.10% 85.90% 0.00% 0.00% NA
Tropical Japonica  504 74.20% 25.80% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723409844 T -> DEL N N silent_mutation Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0723409844 T -> C LOC_Os07g39040.1 upstream_gene_variant ; 1304.0bp to feature; MODIFIER silent_mutation Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0723409844 T -> C LOC_Os07g39040-LOC_Os07g39060 intergenic_region ; MODIFIER silent_mutation Average:38.315; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723409844 1.25E-20 5.59E-66 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 1.02E-12 3.44E-22 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 NA 5.83E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 1.01E-06 1.01E-06 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 NA 4.90E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 3.91E-34 2.66E-99 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 8.89E-09 1.41E-08 mr1563_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 3.42E-20 1.71E-31 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 NA 7.41E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 NA 3.41E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723409844 NA 9.25E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251