Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0723388086:

Variant ID: vg0723388086 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23388086
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCCTTAATTGGGAGACGAGTGTCCACGTGAGCAGGGGGTGGACGTTCGGTTAGACTGAAAAATTCAGTCTTGGTTTATGGTCTTTCGGTCATTTCAGT[A/C]
TTTGAAAACTTAGGACTGAATTTCATCCTAAAAAAACACAGGGCTGGCAAATTCAATTTCAGTCTTTTCGGTCTCGGTCTTGGTCCGACTGAAATTTTTC

Reverse complement sequence

GAAAAATTTCAGTCGGACCAAGACCGAGACCGAAAAGACTGAAATTGAATTTGCCAGCCCTGTGTTTTTTTAGGATGAAATTCAGTCCTAAGTTTTCAAA[T/G]
ACTGAAATGACCGAAAGACCATAAACCAAGACTGAATTTTTCAGTCTAACCGAACGTCCACCCCCTGCTCACGTGGACACTCGTCTCCCAATTAAGGCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.60% 22.50% 23.99% 21.92% NA
All Indica  2759 23.90% 5.60% 35.45% 35.05% NA
All Japonica  1512 41.40% 54.20% 3.97% 0.40% NA
Aus  269 65.10% 0.70% 27.51% 6.69% NA
Indica I  595 14.80% 4.50% 41.18% 39.50% NA
Indica II  465 25.20% 12.50% 28.60% 33.76% NA
Indica III  913 27.90% 1.50% 37.57% 32.97% NA
Indica Intermediate  786 25.40% 7.00% 32.70% 34.86% NA
Temperate Japonica  767 14.60% 85.00% 0.13% 0.26% NA
Tropical Japonica  504 72.80% 17.50% 9.33% 0.40% NA
Japonica Intermediate  241 61.00% 33.20% 4.98% 0.83% NA
VI/Aromatic  96 6.20% 62.50% 2.08% 29.17% NA
Intermediate  90 31.10% 27.80% 22.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723388086 A -> DEL N N silent_mutation Average:57.534; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg0723388086 A -> C LOC_Os07g39010.1 upstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:57.534; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg0723388086 A -> C LOC_Os07g39010.2 upstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:57.534; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg0723388086 A -> C LOC_Os07g39000-LOC_Os07g39010 intergenic_region ; MODIFIER silent_mutation Average:57.534; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723388086 A C -0.02 -0.03 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723388086 NA 1.27E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 4.41E-22 2.72E-69 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 4.06E-12 2.23E-21 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 NA 2.08E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 NA 4.43E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 1.18E-36 1.19E-106 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 9.75E-11 5.88E-11 mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 2.99E-18 4.91E-29 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 NA 2.06E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723388086 NA 2.84E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251