\
| Variant ID: vg0723355917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23355917 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTAATAAACTTAGTGAAGTGAGCATAATTAAACCGATTAGGTTCATGGTAGTATAACCTGCCCATTTTGGTTGAAGTCTTAGACTTGTTCAGGATGTT[C/T]
ATATTCACGGCTAATTTTTTCAGTGATATATGATGTACCCATCAATAACAAAGTCCTCTGGAATACATCTTTATTGTATTTCACAAAAAGGAAAACTAAT
ATTAGTTTTCCTTTTTGTGAAATACAATAAAGATGTATTCCAGAGGACTTTGTTATTGATGGGTACATCATATATCACTGAAAAAATTAGCCGTGAATAT[G/A]
AACATCCTGAACAAGTCTAAGACTTCAACCAAAATGGGCAGGTTATACTACCATGAACCTAATCGGTTTAATTATGCTCACTTCACTAAGTTTATTAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 67.50% | 32.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 86.80% | 13.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 46.40% | 53.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723355917 | C -> T | LOC_Os07g38960.1 | upstream_gene_variant ; 1766.0bp to feature; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0723355917 | C -> T | LOC_Os07g38960.2 | upstream_gene_variant ; 1766.0bp to feature; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0723355917 | C -> T | LOC_Os07g38940.1 | downstream_gene_variant ; 3429.0bp to feature; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0723355917 | C -> T | LOC_Os07g38950.1 | downstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| vg0723355917 | C -> T | LOC_Os07g38950-LOC_Os07g38960 | intergenic_region ; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723355917 | NA | 4.39E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723355917 | 6.71E-14 | NA | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723355917 | 5.70E-13 | 1.81E-21 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723355917 | NA | 1.79E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723355917 | 1.53E-23 | NA | mr1563_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723355917 | 2.97E-19 | 3.75E-27 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |