Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0723355917:

Variant ID: vg0723355917 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23355917
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTAATAAACTTAGTGAAGTGAGCATAATTAAACCGATTAGGTTCATGGTAGTATAACCTGCCCATTTTGGTTGAAGTCTTAGACTTGTTCAGGATGTT[C/T]
ATATTCACGGCTAATTTTTTCAGTGATATATGATGTACCCATCAATAACAAAGTCCTCTGGAATACATCTTTATTGTATTTCACAAAAAGGAAAACTAAT

Reverse complement sequence

ATTAGTTTTCCTTTTTGTGAAATACAATAAAGATGTATTCCAGAGGACTTTGTTATTGATGGGTACATCATATATCACTGAAAAAATTAGCCGTGAATAT[G/A]
AACATCCTGAACAAGTCTAAGACTTCAACCAAAATGGGCAGGTTATACTACCATGAACCTAATCGGTTTAATTATGCTCACTTCACTAAGTTTATTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	12.10%	0.17%	0.00%	NA
All Indica	2759	97.30%	2.50%	0.18%	0.00%	NA
All Japonica	1512	67.50%	32.30%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	95.50%	4.10%	0.43%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	94.90%	5.00%	0.13%	0.00%	NA
Temperate Japonica	767	86.80%	13.00%	0.13%	0.00%	NA
Tropical Japonica	504	46.40%	53.60%	0.00%	0.00%	NA
Japonica Intermediate	241	50.20%	49.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723355917	C -> T	LOC_Os07g38960.1	upstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg0723355917	C -> T	LOC_Os07g38960.2	upstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg0723355917	C -> T	LOC_Os07g38940.1	downstream_gene_variant ; 3429.0bp to feature; MODIFIER	silent_mutation	Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg0723355917	C -> T	LOC_Os07g38950.1	downstream_gene_variant ; 1136.0bp to feature; MODIFIER	silent_mutation	Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg0723355917	C -> T	LOC_Os07g38950-LOC_Os07g38960	intergenic_region ; MODIFIER	silent_mutation	Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723355917	NA	4.39E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917	6.71E-14	NA	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917	5.70E-13	1.81E-21	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917	NA	1.79E-11	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917	1.53E-23	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917	2.97E-19	3.75E-27	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251