\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723355917:

Variant ID: vg0723355917 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23355917
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTAATAAACTTAGTGAAGTGAGCATAATTAAACCGATTAGGTTCATGGTAGTATAACCTGCCCATTTTGGTTGAAGTCTTAGACTTGTTCAGGATGTT[C/T]
ATATTCACGGCTAATTTTTTCAGTGATATATGATGTACCCATCAATAACAAAGTCCTCTGGAATACATCTTTATTGTATTTCACAAAAAGGAAAACTAAT

Reverse complement sequence

ATTAGTTTTCCTTTTTGTGAAATACAATAAAGATGTATTCCAGAGGACTTTGTTATTGATGGGTACATCATATATCACTGAAAAAATTAGCCGTGAATAT[G/A]
AACATCCTGAACAAGTCTAAGACTTCAACCAAAATGGGCAGGTTATACTACCATGAACCTAATCGGTTTAATTATGCTCACTTCACTAAGTTTATTAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.10% 0.17% 0.00% NA
All Indica  2759 97.30% 2.50% 0.18% 0.00% NA
All Japonica  1512 67.50% 32.30% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 95.50% 4.10% 0.43% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.13% 0.00% NA
Temperate Japonica  767 86.80% 13.00% 0.13% 0.00% NA
Tropical Japonica  504 46.40% 53.60% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723355917 C -> T LOC_Os07g38960.1 upstream_gene_variant ; 1766.0bp to feature; MODIFIER silent_mutation Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0723355917 C -> T LOC_Os07g38960.2 upstream_gene_variant ; 1766.0bp to feature; MODIFIER silent_mutation Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0723355917 C -> T LOC_Os07g38940.1 downstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0723355917 C -> T LOC_Os07g38950.1 downstream_gene_variant ; 1136.0bp to feature; MODIFIER silent_mutation Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0723355917 C -> T LOC_Os07g38950-LOC_Os07g38960 intergenic_region ; MODIFIER silent_mutation Average:48.219; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723355917 NA 4.39E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917 6.71E-14 NA mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917 5.70E-13 1.81E-21 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917 NA 1.79E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917 1.53E-23 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723355917 2.97E-19 3.75E-27 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251