\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723340885:

Variant ID: vg0723340885 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23340885
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTACCGACAGCACAGGACAGTCAACTTTTAGGGTTGGTTTTTCTCGAGTGCGACAAGGGCCAGAGATCGGGGCTTAATAGCACCCTTGACTCCTGTTCCG[T/C]
GACGATCTTTGAGAGTCGAATAGGGTCACCGACCCAGCCGTGCAAACGTGCAATGGCACCATGTGGGTTTACAAATTTCAGGTTCGCATGAACATAATTT

Reverse complement sequence

AAATTATGTTCATGCGAACCTGAAATTTGTAAACCCACATGGTGCCATTGCACGTTTGCACGGCTGGGTCGGTGACCCTATTCGACTCTCAAAGATCGTC[A/G]
CGGAACAGGAGTCAAGGGTGCTATTAAGCCCCGATCTCTGGCCCTTGTCGCACTCGAGAAAAACCAACCCTAAAAGTTGACTGTCCTGTGCTGTCGGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.70% 0.00% 0.00% NA
All Indica  2759 96.20% 3.80% 0.00% 0.00% NA
All Japonica  1512 38.80% 61.20% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.20% 0.00% 0.00% NA
Temperate Japonica  767 13.70% 86.30% 0.00% 0.00% NA
Tropical Japonica  504 68.30% 31.70% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.70% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723340885 T -> C LOC_Os07g38930.1 upstream_gene_variant ; 3204.0bp to feature; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N
vg0723340885 T -> C LOC_Os07g38930.4 upstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N
vg0723340885 T -> C LOC_Os07g38930.2 upstream_gene_variant ; 3946.0bp to feature; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N
vg0723340885 T -> C LOC_Os07g38930.5 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N
vg0723340885 T -> C LOC_Os07g38930.3 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N
vg0723340885 T -> C LOC_Os07g38910-LOC_Os07g38930 intergenic_region ; MODIFIER silent_mutation Average:81.181; most accessible tissue: Callus, score: 94.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723340885 T C -0.27 -0.06 -0.05 -0.12 -0.13 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723340885 NA 9.61E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 7.93E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 3.51E-31 5.51E-83 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 2.13E-15 5.86E-25 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 1.57E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 2.62E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 2.36E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 7.97E-56 1.69E-133 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 9.75E-31 1.67E-38 mr1563_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 4.45E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 3.36E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 2.44E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723340885 NA 1.48E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251