\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723326000:

Variant ID: vg0723326000 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23326000
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGGCGAGGTCGACGAGGTTGGTCGCGTCGACGACCTCGCCGACCGGGAGGAACTCGAAGTAGGCCGTGTTGGGCATGATGGTGTAGGACACCTCGGA[C/T]
GGGTCGCACACGGGGCGGAGGTTGATGCCGAAGAAACACTCGGAGGACGCATACGAGGTGCTCACGATCGGCAGGCCGCCACTGTAGTACTGCAGGGTCC

Reverse complement sequence

GGACCCTGCAGTACTACAGTGGCGGCCTGCCGATCGTGAGCACCTCGTATGCGTCCTCCGAGTGTTTCTTCGGCATCAACCTCCGCCCCGTGTGCGACCC[G/A]
TCCGAGGTGTCCTACACCATCATGCCCAACACGGCCTACTTCGAGTTCCTCCCGGTCGGCGAGGTCGTCGACGCGACCAACCTCGTCGACCTCGCCCGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 23.40% 0.04% 0.17% NA
All Indica  2759 96.30% 3.50% 0.00% 0.22% NA
All Japonica  1512 38.80% 61.10% 0.00% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.00% 0.17% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.20% 1.40% 0.00% 0.33% NA
Indica Intermediate  786 93.90% 5.90% 0.00% 0.25% NA
Temperate Japonica  767 13.70% 86.30% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 42.70% 0.00% 0.41% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723326000 C -> DEL LOC_Os07g38890.1 N frameshift_variant Average:89.21; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N
vg0723326000 C -> T LOC_Os07g38890.1 synonymous_variant ; p.Pro195Pro; LOW synonymous_codon Average:89.21; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723326000 C T 0.0 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723326000 NA 3.30E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 2.61E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 2.97E-34 3.45E-88 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 1.54E-19 1.01E-28 mr1563 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 1.76E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 2.88E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 7.90E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 3.37E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 3.22E-50 1.11E-129 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 4.58E-25 4.92E-34 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 9.56E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 1.82E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 6.62E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723326000 NA 8.92E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251