Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723286270:

Variant ID: vg0723286270 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23286270
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.33, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTGAACTAAAGTAACTGAGTACACTTTTCAACATTTATCTTATATTCTGTAAACAAATACTCCCTCCGTTTCACAAAGTAAGTCATTATAACATTTC[C/T]
CACATTCATATTGATGTTAATGAATCTAGATAGATATATATATGTCTAGATTCATTAACATCAATATGAATATGGGAAATACTAGAATGACTTACATTGT

Reverse complement sequence

ACAATGTAAGTCATTCTAGTATTTCCCATATTCATATTGATGTTAATGAATCTAGACATATATATATCTATCTAGATTCATTAACATCAATATGAATGTG[G/A]
GAAATGTTATAATGACTTACTTTGTGAAACGGAGGGAGTATTTGTTTACAGAATATAAGATAAATGTTGAAAAGTGTACTCAGTTACTTTAGTTCAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	39.10%	0.21%	0.00%	NA
All Indica	2759	88.60%	11.20%	0.22%	0.00%	NA
All Japonica	1512	7.90%	92.00%	0.13%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.10%	2.40%	0.50%	0.00%	NA
Indica II	465	83.40%	16.10%	0.43%	0.00%	NA
Indica III	913	86.10%	13.80%	0.11%	0.00%	NA
Indica Intermediate	786	88.20%	11.80%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	15.10%	84.90%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.00%	0.83%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	41.10%	56.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723286270	C -> T	LOC_Os07g38810.1	upstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:20.541; most accessible tissue: Callus, score: 38.918	N	N	N	N
vg0723286270	C -> T	LOC_Os07g38820.1	downstream_gene_variant ; 3008.0bp to feature; MODIFIER	silent_mutation	Average:20.541; most accessible tissue: Callus, score: 38.918	N	N	N	N
vg0723286270	C -> T	LOC_Os07g38810-LOC_Os07g38820	intergenic_region ; MODIFIER	silent_mutation	Average:20.541; most accessible tissue: Callus, score: 38.918	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723286270	NA	3.02E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286270	4.82E-06	NA	mr1702	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286270	NA	2.66E-26	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286270	NA	4.71E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286270	NA	5.01E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251