\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723279898:

Variant ID: vg0723279898 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23279898
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTCTGTAAACTCTCCCAAACCCTCCAACACCCAGCAAATTTCTATCCTTGAACCCATCCGTCGCGCGGAACAAATCCTTGTATGCGAACCGGTGCGG[A/G,C]
CCAAACTCATCCTCCCAATCTTCCCGCACCTCGGCGAAGCGGCGCCGCCGCCGCACGACGAAGAAGACGGCAGCTAGCACCGCAGCGACGAGAAATGCGG

Reverse complement sequence

CCGCATTTCTCGTCGCTGCGGTGCTAGCTGCCGTCTTCTTCGTCGTGCGGCGGCGGCGCCGCTTCGCCGAGGTGCGGGAAGATTGGGAGGATGAGTTTGG[T/C,G]
CCGCACCGGTTCGCATACAAGGATTTGTTCCGCGCGACGGATGGGTTCAAGGATAGAAATTTGCTGGGTGTTGGAGGGTTTGGGAGAGTTTACAGAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.60% 0.28% 0.00% NA
All Indica  2759 95.90% 3.80% 0.29% 0.00% NA
All Japonica  1512 14.00% 85.70% 0.26% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 93.50% 5.80% 0.65% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 93.50% 6.00% 0.51% 0.00% NA
Temperate Japonica  767 8.20% 91.70% 0.13% 0.00% NA
Tropical Japonica  504 17.50% 82.50% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 73.40% 1.24% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723279898 A -> G LOC_Os07g38800.1 synonymous_variant ; p.Gly352Gly; LOW synonymous_codon Average:78.189; most accessible tissue: Minghui63 flag leaf, score: 90.986 N N N N
vg0723279898 A -> C LOC_Os07g38800.1 synonymous_variant ; p.Gly352Gly; LOW N Average:78.189; most accessible tissue: Minghui63 flag leaf, score: 90.986 N N N N
vg0723279898 A -> C LOC_Os07g38790.1 upstream_gene_variant ; 3318.0bp to feature; MODIFIER N Average:78.189; most accessible tissue: Minghui63 flag leaf, score: 90.986 N N N N
vg0723279898 A -> C LOC_Os07g38810.1 downstream_gene_variant ; 2653.0bp to feature; MODIFIER N Average:78.189; most accessible tissue: Minghui63 flag leaf, score: 90.986 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723279898 A C -0.03 -0.03 -0.03 -0.02 -0.03 -0.04
vg0723279898 A G -0.01 -0.02 -0.02 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723279898 5.05E-07 2.97E-09 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723279898 NA 5.80E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 2.47E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 2.31E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.64E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.80E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 9.33E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.47E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 4.64E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.09E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.46E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 5.32E-34 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 7.47E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 6.66E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 1.32E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 3.91E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 1.96E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723279898 NA 5.19E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251