\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723278269:

Variant ID: vg0723278269 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 23278269
Reference Allele: TAAlternative Allele: AA,T,TAAAA,TAA
Primary Allele: AASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTATATGCTTAGGCTGCGTTCGGATGAGGGGGTTTCTAACCCCTCTGCCTCGTTTTCCGCACGCACGCTTTTCAAACTGCTAAATGGTGTGTTTTTTT[TA/AA,T,TAAAA,TAA]
AAAAAATTTATATACGAAAGTTGCTTTTAAAAAAATCAAATTAATCCTTTTTGGAAAAAATAAATAGCTAATATTTAATTAATCACGCGCTAATGGACCG

Reverse complement sequence

CGGTCCATTAGCGCGTGATTAATTAAATATTAGCTATTTATTTTTTCCAAAAAGGATTAATTTGATTTTTTTAAAAGCAACTTTCGTATATAAATTTTTT[TA/TT,A,TTTTA,TTA]
AAAAAAACACACCATTTAGCAGTTTGAAAAGCGTGCGTGCGGAAAACGAGGCAGAGGGGTTAGAAACCCCCTCATCCGAACGCAGCCTAAGCATATAATG

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 40.20% 0.87% 0.00% T: 0.68%; TAAAA: 0.02%; TAA: 0.02%
All Indica  2759 74.00% 25.30% 0.69% 0.00% NA
All Japonica  1512 35.80% 61.20% 1.06% 0.00% T: 1.92%; TAAAA: 0.07%
Aus  269 33.50% 65.80% 0.00% 0.00% T: 0.74%
Indica I  595 95.50% 3.70% 0.84% 0.00% NA
Indica II  465 74.00% 25.80% 0.22% 0.00% NA
Indica III  913 64.60% 35.30% 0.11% 0.00% NA
Indica Intermediate  786 68.70% 29.80% 1.53% 0.00% NA
Temperate Japonica  767 19.60% 78.60% 1.69% 0.00% T: 0.13%
Tropical Japonica  504 49.00% 46.00% 0.20% 0.00% T: 4.56%; TAAAA: 0.20%
Japonica Intermediate  241 59.80% 37.30% 0.83% 0.00% T: 2.07%
VI/Aromatic  96 38.50% 57.30% 3.12% 0.00% TAA: 1.04%
Intermediate  90 47.80% 47.80% 3.33% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723278269 TA -> TAA LOC_Os07g38790.1 upstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAA LOC_Os07g38800.1 downstream_gene_variant ; 190.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAA LOC_Os07g38810.1 downstream_gene_variant ; 4280.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAA LOC_Os07g38790-LOC_Os07g38800 intergenic_region ; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAAAA LOC_Os07g38790.1 upstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAAAA LOC_Os07g38800.1 downstream_gene_variant ; 190.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAAAA LOC_Os07g38810.1 downstream_gene_variant ; 4280.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> TAAAA LOC_Os07g38790-LOC_Os07g38800 intergenic_region ; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> AA LOC_Os07g38790.1 upstream_gene_variant ; 1689.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> AA LOC_Os07g38800.1 downstream_gene_variant ; 192.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> AA LOC_Os07g38810.1 downstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> AA LOC_Os07g38790-LOC_Os07g38800 intergenic_region ; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> T LOC_Os07g38790.1 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> T LOC_Os07g38800.1 downstream_gene_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> T LOC_Os07g38810.1 downstream_gene_variant ; 4281.0bp to feature; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N
vg0723278269 TA -> T LOC_Os07g38790-LOC_Os07g38800 intergenic_region ; MODIFIER silent_mutation Average:51.183; most accessible tissue: Callus, score: 75.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723278269 NA 2.27E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 1.15E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 9.21E-06 9.21E-06 mr1175 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 6.06E-07 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 2.01E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 7.10E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 7.10E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 5.51E-12 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 3.76E-06 mr1616 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 4.34E-06 4.34E-06 mr1663 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 1.61E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 9.67E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 2.71E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 9.79E-06 mr1820 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 6.01E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 3.45E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 2.51E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 7.55E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 4.59E-06 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 2.05E-09 2.03E-19 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723278269 NA 4.72E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251