\
| Variant ID: vg0723278269 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 23278269 |
| Reference Allele: TA | Alternative Allele: AA,T,TAAAA,TAA |
| Primary Allele: AA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
CATTATATGCTTAGGCTGCGTTCGGATGAGGGGGTTTCTAACCCCTCTGCCTCGTTTTCCGCACGCACGCTTTTCAAACTGCTAAATGGTGTGTTTTTTT[TA/AA,T,TAAAA,TAA]
AAAAAATTTATATACGAAAGTTGCTTTTAAAAAAATCAAATTAATCCTTTTTGGAAAAAATAAATAGCTAATATTTAATTAATCACGCGCTAATGGACCG
CGGTCCATTAGCGCGTGATTAATTAAATATTAGCTATTTATTTTTTCCAAAAAGGATTAATTTGATTTTTTTAAAAGCAACTTTCGTATATAAATTTTTT[TA/TT,A,TTTTA,TTA]
AAAAAAACACACCATTTAGCAGTTTGAAAAGCGTGCGTGCGGAAAACGAGGCAGAGGGGTTAGAAACCCCCTCATCCGAACGCAGCCTAAGCATATAATG
| Populations | Population Size | Frequency of AA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 40.20% | 0.87% | 0.00% | T: 0.68%; TAAAA: 0.02%; TAA: 0.02% |
| All Indica | 2759 | 74.00% | 25.30% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 35.80% | 61.20% | 1.06% | 0.00% | T: 1.92%; TAAAA: 0.07% |
| Aus | 269 | 33.50% | 65.80% | 0.00% | 0.00% | T: 0.74% |
| Indica I | 595 | 95.50% | 3.70% | 0.84% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 64.60% | 35.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 68.70% | 29.80% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 19.60% | 78.60% | 1.69% | 0.00% | T: 0.13% |
| Tropical Japonica | 504 | 49.00% | 46.00% | 0.20% | 0.00% | T: 4.56%; TAAAA: 0.20% |
| Japonica Intermediate | 241 | 59.80% | 37.30% | 0.83% | 0.00% | T: 2.07% |
| VI/Aromatic | 96 | 38.50% | 57.30% | 3.12% | 0.00% | TAA: 1.04% |
| Intermediate | 90 | 47.80% | 47.80% | 3.33% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723278269 | TA -> TAA | LOC_Os07g38790.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAA | LOC_Os07g38800.1 | downstream_gene_variant ; 190.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAA | LOC_Os07g38810.1 | downstream_gene_variant ; 4280.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAA | LOC_Os07g38790-LOC_Os07g38800 | intergenic_region ; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAAAA | LOC_Os07g38790.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAAAA | LOC_Os07g38800.1 | downstream_gene_variant ; 190.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAAAA | LOC_Os07g38810.1 | downstream_gene_variant ; 4280.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> TAAAA | LOC_Os07g38790-LOC_Os07g38800 | intergenic_region ; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> AA | LOC_Os07g38790.1 | upstream_gene_variant ; 1689.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> AA | LOC_Os07g38800.1 | downstream_gene_variant ; 192.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> AA | LOC_Os07g38810.1 | downstream_gene_variant ; 4282.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> AA | LOC_Os07g38790-LOC_Os07g38800 | intergenic_region ; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> T | LOC_Os07g38790.1 | upstream_gene_variant ; 1690.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> T | LOC_Os07g38800.1 | downstream_gene_variant ; 191.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> T | LOC_Os07g38810.1 | downstream_gene_variant ; 4281.0bp to feature; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| vg0723278269 | TA -> T | LOC_Os07g38790-LOC_Os07g38800 | intergenic_region ; MODIFIER | silent_mutation | Average:51.183; most accessible tissue: Callus, score: 75.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723278269 | NA | 2.27E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 1.15E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | 9.21E-06 | 9.21E-06 | mr1175 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 6.06E-07 | mr1186 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 2.01E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 7.10E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 7.10E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 5.51E-12 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 3.76E-06 | mr1616 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | 4.34E-06 | 4.34E-06 | mr1663 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 1.61E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 9.67E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 2.71E-06 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 9.79E-06 | mr1820 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 6.01E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 3.45E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 2.51E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 7.55E-06 | mr1170_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | 4.59E-06 | NA | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | 2.05E-09 | 2.03E-19 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723278269 | NA | 4.72E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |