Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723230135:

Variant ID: vg0723230135 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23230135
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAAAGTTTTCATATAAGAACCCAATACAAGATTAATAAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAGAAAAGAAAAGGATAGTCCAAG[T/C]
AGGAATACAATTTTAAAATAGTTGAAATTCAGAATTAAAAATAAGGAATATTAAAAGAAGAGTCCGTATAAAAACCTAATACGAGATTAAATAAAATTGG

Reverse complement sequence

CCAATTTTATTTAATCTCGTATTAGGTTTTTATACGGACTCTTCTTTTAATATTCCTTATTTTTAATTCTGAATTTCAACTATTTTAAAATTGTATTCCT[A/G]
CTTGGACTATCCTTTTCTTTTCTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTTATTAATCTTGTATTGGGTTCTTATATGAAAACTTTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	11.80%	0.47%	0.23%	NA
All Indica	2759	99.10%	0.20%	0.33%	0.40%	NA
All Japonica	1512	66.40%	33.00%	0.60%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	0.40%	0.86%	1.29%	NA
Indica III	913	99.20%	0.30%	0.11%	0.33%	NA
Indica Intermediate	786	99.10%	0.10%	0.51%	0.25%	NA
Temperate Japonica	767	63.80%	35.90%	0.39%	0.00%	NA
Tropical Japonica	504	67.30%	32.50%	0.20%	0.00%	NA
Japonica Intermediate	241	73.00%	24.90%	2.07%	0.00%	NA
VI/Aromatic	96	49.00%	46.90%	4.17%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723230135	T -> DEL	N	N	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0723230135	T -> C	LOC_Os07g38680.1	upstream_gene_variant ; 3980.0bp to feature; MODIFIER	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0723230135	T -> C	LOC_Os07g38710.1	upstream_gene_variant ; 3609.0bp to feature; MODIFIER	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0723230135	T -> C	LOC_Os07g38690.1	downstream_gene_variant ; 2156.0bp to feature; MODIFIER	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0723230135	T -> C	LOC_Os07g38700.1	downstream_gene_variant ; 830.0bp to feature; MODIFIER	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0723230135	T -> C	LOC_Os07g38700-LOC_Os07g38710	intergenic_region ; MODIFIER	silent_mutation	Average:11.383; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723230135	1.82E-06	4.47E-09	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723230135	NA	4.80E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723230135	6.49E-07	1.80E-11	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723230135	NA	3.92E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723230135	NA	5.13E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251