\
| Variant ID: vg0723222806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23222806 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 94. )
TATCTCTCACTTATACATTTAATGTATTTGTCTTGAACCTTGTGATAAGTTAGCTCTTGCATGAGAGCCAACATCCTTAATTTTTCACTACCTCTCTCCT[C/T]
CACCTAAGCTTATAGTATGCTTATAGCTCACTATTATACTTGCTCTTATGCTACTAGTACGTACTACTGTAGTTTGCAATTTGCAGTGTTTTCTTTCTTC
GAAGAAAGAAAACACTGCAAATTGCAAACTACAGTAGTACGTACTAGTAGCATAAGAGCAAGTATAATAGTGAGCTATAAGCATACTATAAGCTTAGGTG[G/A]
AGGAGAGAGGTAGTGAAAAATTAAGGATGTTGGCTCTCATGCAAGAGCTAACTTATCACAAGGTTCAAGACAAATACATTAAATGTATAAGTGAGAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 13.00% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 83.40% | 16.10% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.50% | 59.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.00% | 1.18% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.30% | 20.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723222806 | C -> T | LOC_Os07g38670.1 | upstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:61.106; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0723222806 | C -> T | LOC_Os07g38690.1 | upstream_gene_variant ; 4578.0bp to feature; MODIFIER | silent_mutation | Average:61.106; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0723222806 | C -> T | LOC_Os07g38664.1 | downstream_gene_variant ; 1855.0bp to feature; MODIFIER | silent_mutation | Average:61.106; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0723222806 | C -> T | LOC_Os07g38680.1 | downstream_gene_variant ; 3026.0bp to feature; MODIFIER | silent_mutation | Average:61.106; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0723222806 | C -> T | LOC_Os07g38664-LOC_Os07g38670 | intergenic_region ; MODIFIER | silent_mutation | Average:61.106; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723222806 | 6.39E-06 | 1.63E-08 | mr1376 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723222806 | 6.39E-06 | 1.63E-08 | mr1431 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723222806 | NA | 1.79E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723222806 | NA | 4.96E-06 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |