\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723127888:

Variant ID: vg0723127888 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23127888
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGTCTCCGCGCGGTGACTTCGGGTGCGTGGTGCTTCATATTCTCGACTCCGAGCCCCGAGTCTGGACGTCTCATCTTTTCGTATCTTTGACTTGCTCA[A/G]
TTCGTCTCGAGTCTGGACGTCTCATCTTCTCCGAGCACCAGGCCGCTAGCCGGCTCATCCAATTTCATATTTTCATTCAACCGGCAAATAGCAACTTAGC

Reverse complement sequence

GCTAAGTTGCTATTTGCCGGTTGAATGAAAATATGAAATTGGATGAGCCGGCTAGCGGCCTGGTGCTCGGAGAAGATGAGACGTCCAGACTCGAGACGAA[T/C]
TGAGCAAGTCAAAGATACGAAAAGATGAGACGTCCAGACTCGGGGCTCGGAGTCGAGAATATGAAGCACCACGCACCCGAAGTCACCGCGCGGAGACACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.80% 0.04% 0.00% NA
All Indica  2759 85.20% 14.70% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 81.70% 17.80% 0.43% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 84.70% 15.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723127888 A -> G LOC_Os07g38490-LOC_Os07g38500 intergenic_region ; MODIFIER silent_mutation Average:79.68; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723127888 A G -0.02 -0.03 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723127888 NA 3.27E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 3.01E-06 1.09E-08 mr1304 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 5.21E-07 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 5.21E-07 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 6.73E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 1.45E-06 mr1820 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 1.42E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 7.28E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723127888 NA 9.89E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251