\
| Variant ID: vg0723101562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23101562 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
AAAGTAGAGTTGACGCACGACTGCATAAGGATGATGAAGCTAACGACAGCTACAATGGAGATGTCAAGACGCTGTAACTGGCGAATGAGATCTCTACAAC[C/T]
TGGTGTGGAAGCGGGAGGAAGAAAGCCATATTGGTATGCTTTGCAAATCTTGATGTTTCAACAAATGGACTACAATTTTTCACGGGCAATAGTGAAATGT
ACATTTCACTATTGCCCGTGAAAAATTGTAGTCCATTTGTTGAAACATCAAGATTTGCAAAGCATACCAATATGGCTTTCTTCCTCCCGCTTCCACACCA[G/A]
GTTGTAGAGATCTCATTCGCCAGTTACAGCGTCTTGACATCTCCATTGTAGCTGTCGTTAGCTTCATCATCCTTATGCAGTCGTGCGTCAACTCTACTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.00% | 13.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 23.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723101562 | C -> T | LOC_Os07g38460.1 | upstream_gene_variant ; 4684.0bp to feature; MODIFIER | silent_mutation | Average:40.674; most accessible tissue: Callus, score: 75.754 | N | N | N | N |
| vg0723101562 | C -> T | LOC_Os07g38440.1 | downstream_gene_variant ; 1113.0bp to feature; MODIFIER | silent_mutation | Average:40.674; most accessible tissue: Callus, score: 75.754 | N | N | N | N |
| vg0723101562 | C -> T | LOC_Os07g38450.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.674; most accessible tissue: Callus, score: 75.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723101562 | NA | 6.19E-18 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0723101562 | NA | 5.97E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0723101562 | NA | 3.12E-10 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723101562 | 2.02E-08 | 7.04E-19 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723101562 | NA | 9.14E-08 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723101562 | NA | 9.15E-12 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723101562 | 1.02E-08 | 3.99E-23 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723101562 | NA | 3.87E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |