\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723101562:

Variant ID: vg0723101562 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23101562
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTAGAGTTGACGCACGACTGCATAAGGATGATGAAGCTAACGACAGCTACAATGGAGATGTCAAGACGCTGTAACTGGCGAATGAGATCTCTACAAC[C/T]
TGGTGTGGAAGCGGGAGGAAGAAAGCCATATTGGTATGCTTTGCAAATCTTGATGTTTCAACAAATGGACTACAATTTTTCACGGGCAATAGTGAAATGT

Reverse complement sequence

ACATTTCACTATTGCCCGTGAAAAATTGTAGTCCATTTGTTGAAACATCAAGATTTGCAAAGCATACCAATATGGCTTTCTTCCTCCCGCTTCCACACCA[G/A]
GTTGTAGAGATCTCATTCGCCAGTTACAGCGTCTTGACATCTCCATTGTAGCTGTCGTTAGCTTCATCATCCTTATGCAGTCGTGCGTCAACTCTACTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.02% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 86.00% 13.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 84.70% 15.30% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 23.70% 0.41% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723101562 C -> T LOC_Os07g38460.1 upstream_gene_variant ; 4684.0bp to feature; MODIFIER silent_mutation Average:40.674; most accessible tissue: Callus, score: 75.754 N N N N
vg0723101562 C -> T LOC_Os07g38440.1 downstream_gene_variant ; 1113.0bp to feature; MODIFIER silent_mutation Average:40.674; most accessible tissue: Callus, score: 75.754 N N N N
vg0723101562 C -> T LOC_Os07g38450.1 intron_variant ; MODIFIER silent_mutation Average:40.674; most accessible tissue: Callus, score: 75.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723101562 NA 6.19E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723101562 NA 5.97E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723101562 NA 3.12E-10 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723101562 2.02E-08 7.04E-19 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723101562 NA 9.14E-08 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723101562 NA 9.15E-12 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723101562 1.02E-08 3.99E-23 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723101562 NA 3.87E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251