\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723097242:

Variant ID: vg0723097242 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23097242
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATTCCACAAACATACAAAATCAAATTCAACTTCTACAAGTTGTAACAAAATAACAAAGTAAAATGAAAATGATTAATGTATATTTGCAGCTATATTT[G/A]
TTACAGCTTGTAGAAGTCGAGAATTTGAAATTACATGTTTATGTAGTGATATATTTCATATTAATCTATCTTATATTTTTTTCAACTTTTTTATGGTTGT

Reverse complement sequence

ACAACCATAAAAAAGTTGAAAAAAATATAAGATAGATTAATATGAAATATATCACTACATAAACATGTAATTTCAAATTCTCGACTTCTACAAGCTGTAA[C/T]
AAATATAGCTGCAAATATACATTAATCATTTTCATTTTACTTTGTTATTTTGTTACAACTTGTAGAAGTTGAATTTGATTTTGTATGTTTGTGGAATGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.40% 0.17% 0.00% NA
All Indica  2759 82.40% 17.30% 0.29% 0.00% NA
All Japonica  1512 6.20% 93.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 73.50% 26.00% 0.43% 0.00% NA
Indica III  913 79.40% 20.60% 0.00% 0.00% NA
Indica Intermediate  786 79.50% 19.80% 0.64% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 14.10% 85.90% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723097242 G -> A LOC_Os07g38440.1 upstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg0723097242 G -> A LOC_Os07g38430.1 downstream_gene_variant ; 2782.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg0723097242 G -> A LOC_Os07g38450.1 downstream_gene_variant ; 3908.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg0723097242 G -> A LOC_Os07g38430-LOC_Os07g38440 intergenic_region ; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723097242 G A 0.01 0.01 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723097242 NA 2.78E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 5.61E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 1.90E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.63E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 8.95E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 4.71E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 2.66E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.84E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 1.81E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.40E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 5.17E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.40E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 6.69E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.40E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 4.02E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 1.51E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 1.43E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 8.57E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 5.74E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 5.90E-19 mr1830 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 9.35E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723097242 NA 3.96E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251