\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722937821:

Variant ID: vg0722937821 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22937821
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCTTTGCGATCTAAAAGTAAAGGCTAAAAAATAATTTCGATGAAAAAAATTTCTCAAAATCAGTTTCAAATTTAAGGTTGAAAATTCAAATTTTGACT[A/G]
ATAATTATAAGCATAAGCGAAAAGACGAGGAGCATAAGCATAAGCAAAAATTCAAATTTTGGCGGGACAAAGGATTGCGATCTCGTGAAGGTGAGCTAAC

Reverse complement sequence

GTTAGCTCACCTTCACGAGATCGCAATCCTTTGTCCCGCCAAAATTTGAATTTTTGCTTATGCTTATGCTCCTCGTCTTTTCGCTTATGCTTATAATTAT[T/C]
AGTCAAAATTTGAATTTTCAACCTTAAATTTGAAACTGATTTTGAGAAATTTTTTTCATCGAAATTATTTTTTAGCCTTTACTTTTAGATCGCAAAGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 29.90% 0.11% 0.23% NA
All Indica  2759 77.40% 22.10% 0.07% 0.40% NA
All Japonica  1512 69.60% 30.20% 0.13% 0.00% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 96.80% 3.00% 0.00% 0.17% NA
Indica II  465 70.80% 28.60% 0.00% 0.65% NA
Indica III  913 68.00% 31.70% 0.00% 0.33% NA
Indica Intermediate  786 77.60% 21.60% 0.25% 0.51% NA
Temperate Japonica  767 55.00% 44.70% 0.26% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722937821 A -> DEL N N silent_mutation Average:42.277; most accessible tissue: Callus, score: 76.649 N N N N
vg0722937821 A -> G LOC_Os07g38240.1 downstream_gene_variant ; 4538.0bp to feature; MODIFIER silent_mutation Average:42.277; most accessible tissue: Callus, score: 76.649 N N N N
vg0722937821 A -> G LOC_Os07g38250.1 downstream_gene_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:42.277; most accessible tissue: Callus, score: 76.649 N N N N
vg0722937821 A -> G LOC_Os07g38260.1 downstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:42.277; most accessible tissue: Callus, score: 76.649 N N N N
vg0722937821 A -> G LOC_Os07g38250-LOC_Os07g38260 intergenic_region ; MODIFIER silent_mutation Average:42.277; most accessible tissue: Callus, score: 76.649 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722937821 NA 7.98E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722937821 NA 1.99E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 5.78E-09 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 3.65E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 1.35E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 8.24E-09 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 2.15E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821 NA 3.19E-10 mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251