\
| Variant ID: vg0722937821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22937821 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )
GTTCTTTGCGATCTAAAAGTAAAGGCTAAAAAATAATTTCGATGAAAAAAATTTCTCAAAATCAGTTTCAAATTTAAGGTTGAAAATTCAAATTTTGACT[A/G]
ATAATTATAAGCATAAGCGAAAAGACGAGGAGCATAAGCATAAGCAAAAATTCAAATTTTGGCGGGACAAAGGATTGCGATCTCGTGAAGGTGAGCTAAC
GTTAGCTCACCTTCACGAGATCGCAATCCTTTGTCCCGCCAAAATTTGAATTTTTGCTTATGCTTATGCTCCTCGTCTTTTCGCTTATGCTTATAATTAT[T/C]
AGTCAAAATTTGAATTTTCAACCTTAAATTTGAAACTGATTTTGAGAAATTTTTTTCATCGAAATTATTTTTTAGCCTTTACTTTTAGATCGCAAAGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 29.90% | 0.11% | 0.23% | NA |
| All Indica | 2759 | 77.40% | 22.10% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 69.60% | 30.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 18.20% | 81.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 70.80% | 28.60% | 0.00% | 0.65% | NA |
| Indica III | 913 | 68.00% | 31.70% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 77.60% | 21.60% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 55.00% | 44.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.40% | 38.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722937821 | A -> DEL | N | N | silent_mutation | Average:42.277; most accessible tissue: Callus, score: 76.649 | N | N | N | N |
| vg0722937821 | A -> G | LOC_Os07g38240.1 | downstream_gene_variant ; 4538.0bp to feature; MODIFIER | silent_mutation | Average:42.277; most accessible tissue: Callus, score: 76.649 | N | N | N | N |
| vg0722937821 | A -> G | LOC_Os07g38250.1 | downstream_gene_variant ; 208.0bp to feature; MODIFIER | silent_mutation | Average:42.277; most accessible tissue: Callus, score: 76.649 | N | N | N | N |
| vg0722937821 | A -> G | LOC_Os07g38260.1 | downstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:42.277; most accessible tissue: Callus, score: 76.649 | N | N | N | N |
| vg0722937821 | A -> G | LOC_Os07g38250-LOC_Os07g38260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.277; most accessible tissue: Callus, score: 76.649 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722937821 | NA | 7.98E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722937821 | NA | 1.99E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 5.78E-09 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 3.65E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 1.35E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 8.24E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 2.15E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722937821 | NA | 3.19E-10 | mr1962_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |