Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722937821:

Variant ID: vg0722937821 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22937821
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTTTGCGATCTAAAAGTAAAGGCTAAAAAATAATTTCGATGAAAAAAATTTCTCAAAATCAGTTTCAAATTTAAGGTTGAAAATTCAAATTTTGACT[A/G]
ATAATTATAAGCATAAGCGAAAAGACGAGGAGCATAAGCATAAGCAAAAATTCAAATTTTGGCGGGACAAAGGATTGCGATCTCGTGAAGGTGAGCTAAC

Reverse complement sequence

GTTAGCTCACCTTCACGAGATCGCAATCCTTTGTCCCGCCAAAATTTGAATTTTTGCTTATGCTTATGCTCCTCGTCTTTTCGCTTATGCTTATAATTAT[T/C]
AGTCAAAATTTGAATTTTCAACCTTAAATTTGAAACTGATTTTGAGAAATTTTTTTCATCGAAATTATTTTTTAGCCTTTACTTTTAGATCGCAAAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	29.90%	0.11%	0.23%	NA
All Indica	2759	77.40%	22.10%	0.07%	0.40%	NA
All Japonica	1512	69.60%	30.20%	0.13%	0.00%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	96.80%	3.00%	0.00%	0.17%	NA
Indica II	465	70.80%	28.60%	0.00%	0.65%	NA
Indica III	913	68.00%	31.70%	0.00%	0.33%	NA
Indica Intermediate	786	77.60%	21.60%	0.25%	0.51%	NA
Temperate Japonica	767	55.00%	44.70%	0.26%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	61.40%	38.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722937821	A -> DEL	N	N	silent_mutation	Average:42.277; most accessible tissue: Callus, score: 76.649	N	N	N	N
vg0722937821	A -> G	LOC_Os07g38240.1	downstream_gene_variant ; 4538.0bp to feature; MODIFIER	silent_mutation	Average:42.277; most accessible tissue: Callus, score: 76.649	N	N	N	N
vg0722937821	A -> G	LOC_Os07g38250.1	downstream_gene_variant ; 208.0bp to feature; MODIFIER	silent_mutation	Average:42.277; most accessible tissue: Callus, score: 76.649	N	N	N	N
vg0722937821	A -> G	LOC_Os07g38260.1	downstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:42.277; most accessible tissue: Callus, score: 76.649	N	N	N	N
vg0722937821	A -> G	LOC_Os07g38250-LOC_Os07g38260	intergenic_region ; MODIFIER	silent_mutation	Average:42.277; most accessible tissue: Callus, score: 76.649	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722937821	NA	7.98E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722937821	NA	1.99E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	5.78E-09	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	3.65E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	1.35E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	8.24E-09	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	2.15E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722937821	NA	3.19E-10	mr1962_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251