\
| Variant ID: vg0722912066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22912066 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.01, others allele: 0.00, population size: 236. )
AAGTATCAAAACCACATTTTAATTATAGATGGAATGAGCATTTGCATATTTCTAAGCATGGCTAAGCAAGTAATTGCACATAGAGCATATATAAACCCAT[A/T,G]
TGAGCACAAAGAGTGTACTCTAACCATTTCTAGGGTTCAAACAGCAAGAGGATCAATTATTCAAGGTGGGTTATGCAGCAAATAGGTCATAACTACCTTA
TAAGGTAGTTATGACCTATTTGCTGCATAACCCACCTTGAATAATTGATCCTCTTGCTGTTTGAACCCTAGAAATGGTTAGAGTACACTCTTTGTGCTCA[T/A,C]
ATGGGTTTATATATGCTCTATGTGCAATTACTTGCTTAGCCATGCTTAGAAATATGCAAATGCTCATTCCATCTATAATTAAAATGTGGTTTTGATACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 8.80% | 7.05% | 7.96% | NA |
| All Indica | 2759 | 96.50% | 1.80% | 0.98% | 0.72% | NA |
| All Japonica | 1512 | 33.80% | 23.90% | 19.58% | 22.69% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.00% | 0.84% | 0.17% | NA |
| Indica II | 465 | 93.80% | 4.30% | 1.72% | 0.22% | NA |
| Indica III | 913 | 99.30% | 0.00% | 0.22% | 0.44% | NA |
| Indica Intermediate | 786 | 93.60% | 3.10% | 1.53% | 1.78% | NA |
| Temperate Japonica | 767 | 44.30% | 28.80% | 18.25% | 8.60% | NA |
| Tropical Japonica | 504 | 17.70% | 18.10% | 21.03% | 43.25% | NA |
| Japonica Intermediate | 241 | 34.00% | 20.70% | 20.75% | 24.48% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 5.60% | 11.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722912066 | A -> DEL | N | N | silent_mutation | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> G | LOC_Os07g38200.1 | upstream_gene_variant ; 2467.0bp to feature; MODIFIER | N | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> G | LOC_Os07g38190.1 | downstream_gene_variant ; 1670.0bp to feature; MODIFIER | N | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> G | LOC_Os07g38190-LOC_Os07g38200 | intergenic_region ; MODIFIER | N | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> T | LOC_Os07g38200.1 | upstream_gene_variant ; 2467.0bp to feature; MODIFIER | silent_mutation | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> T | LOC_Os07g38190.1 | downstream_gene_variant ; 1670.0bp to feature; MODIFIER | silent_mutation | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0722912066 | A -> T | LOC_Os07g38190-LOC_Os07g38200 | intergenic_region ; MODIFIER | silent_mutation | Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722912066 | NA | 6.54E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722912066 | NA | 1.70E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 9.35E-07 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 3.57E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 5.12E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | 9.35E-07 | 2.58E-13 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 7.68E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 2.48E-11 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722912066 | NA | 1.11E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |