\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722912066:

Variant ID: vg0722912066 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22912066
Reference Allele: AAlternative Allele: T,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTATCAAAACCACATTTTAATTATAGATGGAATGAGCATTTGCATATTTCTAAGCATGGCTAAGCAAGTAATTGCACATAGAGCATATATAAACCCAT[A/T,G]
TGAGCACAAAGAGTGTACTCTAACCATTTCTAGGGTTCAAACAGCAAGAGGATCAATTATTCAAGGTGGGTTATGCAGCAAATAGGTCATAACTACCTTA

Reverse complement sequence

TAAGGTAGTTATGACCTATTTGCTGCATAACCCACCTTGAATAATTGATCCTCTTGCTGTTTGAACCCTAGAAATGGTTAGAGTACACTCTTTGTGCTCA[T/A,C]
ATGGGTTTATATATGCTCTATGTGCAATTACTTGCTTAGCCATGCTTAGAAATATGCAAATGCTCATTCCATCTATAATTAAAATGTGGTTTTGATACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 8.80% 7.05% 7.96% NA
All Indica  2759 96.50% 1.80% 0.98% 0.72% NA
All Japonica  1512 33.80% 23.90% 19.58% 22.69% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.00% 0.84% 0.17% NA
Indica II  465 93.80% 4.30% 1.72% 0.22% NA
Indica III  913 99.30% 0.00% 0.22% 0.44% NA
Indica Intermediate  786 93.60% 3.10% 1.53% 1.78% NA
Temperate Japonica  767 44.30% 28.80% 18.25% 8.60% NA
Tropical Japonica  504 17.70% 18.10% 21.03% 43.25% NA
Japonica Intermediate  241 34.00% 20.70% 20.75% 24.48% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 5.60% 11.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722912066 A -> DEL N N silent_mutation Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> G LOC_Os07g38200.1 upstream_gene_variant ; 2467.0bp to feature; MODIFIER N Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> G LOC_Os07g38190.1 downstream_gene_variant ; 1670.0bp to feature; MODIFIER N Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> G LOC_Os07g38190-LOC_Os07g38200 intergenic_region ; MODIFIER N Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> T LOC_Os07g38200.1 upstream_gene_variant ; 2467.0bp to feature; MODIFIER silent_mutation Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> T LOC_Os07g38190.1 downstream_gene_variant ; 1670.0bp to feature; MODIFIER silent_mutation Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0722912066 A -> T LOC_Os07g38190-LOC_Os07g38200 intergenic_region ; MODIFIER silent_mutation Average:26.65; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722912066 NA 6.54E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722912066 NA 1.70E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 9.35E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 3.57E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 5.12E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 9.35E-07 2.58E-13 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 7.68E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 2.48E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722912066 NA 1.11E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251