\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722854356:

Variant ID: vg0722854356 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22854356
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTAGAGAGTTTTAGATTATAAGAAACAACTAGTGAAAATTTAGCCGGTGAGAATATGGTTTTTTTTAGCCTCTGGCTTCTAATTTATTTCTTTGATT[C/T]
GACAATTACAACTTCTTAAAATCTGGATTAAAAAACTGAATTATTTAAGAGAATTTTGAATTCAAGGAGAAGCTACATCTGCCCAAAAACTCTCACAAAC

Reverse complement sequence

GTTTGTGAGAGTTTTTGGGCAGATGTAGCTTCTCCTTGAATTCAAAATTCTCTTAAATAATTCAGTTTTTTAATCCAGATTTTAAGAAGTTGTAATTGTC[G/A]
AATCAAAGAAATAAATTAGAAGCCAGAGGCTAAAAAAAACCATATTCTCACCGGCTAAATTTTCACTAGTTGTTTCTTATAATCTAAAACTCTCTAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 16.90% 1.69% 0.00% NA
All Indica  2759 97.00% 2.50% 0.54% 0.00% NA
All Japonica  1512 49.30% 46.50% 4.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.20% 0.50% 0.00% NA
Indica II  465 95.30% 3.90% 0.86% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 94.30% 4.80% 0.89% 0.00% NA
Temperate Japonica  767 71.70% 24.30% 4.04% 0.00% NA
Tropical Japonica  504 25.80% 69.60% 4.56% 0.00% NA
Japonica Intermediate  241 27.40% 68.90% 3.73% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722854356 C -> T LOC_Os07g38100.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0722854356 C -> T LOC_Os07g38110.1 upstream_gene_variant ; 439.0bp to feature; MODIFIER silent_mutation Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0722854356 C -> T LOC_Os07g38110.2 upstream_gene_variant ; 441.0bp to feature; MODIFIER silent_mutation Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0722854356 C -> T LOC_Os07g38120.1 downstream_gene_variant ; 4239.0bp to feature; MODIFIER silent_mutation Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0722854356 C -> T LOC_Os07g38110-LOC_Os07g38120 intergenic_region ; MODIFIER silent_mutation Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722854356 NA 1.13E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722854356 NA 1.33E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 2.94E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 5.94E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 8.92E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 8.59E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.78E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.67E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.05E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 2.29E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 8.09E-11 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 8.95E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.74E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 7.49E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 2.13E-09 mr1604 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 4.12E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.48E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.23E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 8.62E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.55E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 3.48E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 4.23E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356 NA 1.94E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251