Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722854356:

Variant ID: vg0722854356 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22854356
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTTAGAGAGTTTTAGATTATAAGAAACAACTAGTGAAAATTTAGCCGGTGAGAATATGGTTTTTTTTAGCCTCTGGCTTCTAATTTATTTCTTTGATT[C/T]
GACAATTACAACTTCTTAAAATCTGGATTAAAAAACTGAATTATTTAAGAGAATTTTGAATTCAAGGAGAAGCTACATCTGCCCAAAAACTCTCACAAAC

Reverse complement sequence

GTTTGTGAGAGTTTTTGGGCAGATGTAGCTTCTCCTTGAATTCAAAATTCTCTTAAATAATTCAGTTTTTTAATCCAGATTTTAAGAAGTTGTAATTGTC[G/A]
AATCAAAGAAATAAATTAGAAGCCAGAGGCTAAAAAAAACCATATTCTCACCGGCTAAATTTTCACTAGTTGTTTCTTATAATCTAAAACTCTCTAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	16.90%	1.69%	0.00%	NA
All Indica	2759	97.00%	2.50%	0.54%	0.00%	NA
All Japonica	1512	49.30%	46.50%	4.17%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.20%	0.50%	0.00%	NA
Indica II	465	95.30%	3.90%	0.86%	0.00%	NA
Indica III	913	99.20%	0.70%	0.11%	0.00%	NA
Indica Intermediate	786	94.30%	4.80%	0.89%	0.00%	NA
Temperate Japonica	767	71.70%	24.30%	4.04%	0.00%	NA
Tropical Japonica	504	25.80%	69.60%	4.56%	0.00%	NA
Japonica Intermediate	241	27.40%	68.90%	3.73%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722854356	C -> T	LOC_Os07g38100.1	upstream_gene_variant ; 4764.0bp to feature; MODIFIER	silent_mutation	Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0722854356	C -> T	LOC_Os07g38110.1	upstream_gene_variant ; 439.0bp to feature; MODIFIER	silent_mutation	Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0722854356	C -> T	LOC_Os07g38110.2	upstream_gene_variant ; 441.0bp to feature; MODIFIER	silent_mutation	Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0722854356	C -> T	LOC_Os07g38120.1	downstream_gene_variant ; 4239.0bp to feature; MODIFIER	silent_mutation	Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0722854356	C -> T	LOC_Os07g38110-LOC_Os07g38120	intergenic_region ; MODIFIER	silent_mutation	Average:70.076; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722854356	NA	1.13E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722854356	NA	1.33E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	2.94E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	5.94E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	8.92E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	8.59E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.78E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.67E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.05E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	2.29E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	8.09E-11	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	8.95E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.74E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	7.49E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	2.13E-09	mr1604	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	4.12E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.48E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.23E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	8.62E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.55E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	3.48E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	4.23E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722854356	NA	1.94E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251