\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722836934:

Variant ID: vg0722836934 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 22836934
Reference Allele: CAlternative Allele: A,CCGCCGACGA
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACGAAGGCTCTCTGATCCAGATCGGAGGGGGAGGCTCACCTCGCAGTGCAGCGGGGTTAGCACGGCCGGGGACCGACCGGGATCTGGCGCCGCCGCCG[C/A,CCGCCGACGA]
CGACGACGACGACCGCTACCCCGACCGTACGAGGGACACCTGGGATGGGAAGACGATGCGCCGACCTGGACCCTGGAGCTCGATAACGACGAGCGGAAAA

Reverse complement sequence

TTTTCCGCTCGTCGTTATCGAGCTCCAGGGTCCAGGTCGGCGCATCGTCTTCCCATCCCAGGTGTCCCTCGTACGGTCGGGGTAGCGGTCGTCGTCGTCG[G/T,TCGTCGGCGG]
CGGCGGCGGCGCCAGATCCCGGTCGGTCCCCGGCCGTGCTAACCCCGCTGCACTGCGAGGTGAGCCTCCCCCTCCGATCTGGATCAGAGAGCCTTCGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.50% 0.11% 0.00% CCGCCGACGA: 0.04%
All Indica  2759 92.10% 7.80% 0.07% 0.00% NA
All Japonica  1512 77.20% 22.60% 0.13% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 89.20% 10.80% 0.00% 0.00% NA
Indica III  913 88.40% 11.40% 0.22% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 60.40% 39.40% 0.26% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 0.00% CCGCCGACGA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722836934 C -> CCGCCGACGA LOC_Os07g38080.1 5_prime_UTR_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> CCGCCGACGA LOC_Os07g38090.1 upstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> CCGCCGACGA LOC_Os07g38090.2 upstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> CCGCCGACGA LOC_Os07g38080.2 intron_variant ; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> A LOC_Os07g38080.1 5_prime_UTR_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> A LOC_Os07g38090.1 upstream_gene_variant ; 4052.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> A LOC_Os07g38090.2 upstream_gene_variant ; 4052.0bp to feature; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N
vg0722836934 C -> A LOC_Os07g38080.2 intron_variant ; MODIFIER silent_mutation Average:91.403; most accessible tissue: Zhenshan97 flag leaf, score: 95.452 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722836934 C A -0.01 -0.01 -0.01 -0.02 -0.01 -0.02
vg0722836934 C CCGCC* 0.28 0.13 -0.07 0.05 0.06 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722836934 NA 1.35E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722836934 NA 2.14E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722836934 NA 2.55E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722836934 NA 1.29E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 1.88E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 1.24E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 5.76E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 1.62E-11 mr1126_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 8.18E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 3.01E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 4.97E-07 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 1.91E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 3.15E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 9.09E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 2.88E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722836934 NA 7.99E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251