\
| Variant ID: vg0722814740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22814740 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, A: 0.44, others allele: 0.00, population size: 82. )
TTTTGCAGTTACAACCCTGCCAGCTGCGTTCGGGAGAACCCCTCCTCCCTGGCACGCAAAACGGAGCACGCATTATTGCATGATTAATTAAGTATTAGCT[T/A]
TTTTTTTTCAAAAATGGATTAATTTGATTTTTTAAGCAACTTTTGTATAAAAACTTTTTGCAAAAAACACATCGTTTAGCAGTTTGAAAAGCGTGCGCGC
GCGCGCACGCTTTTCAAACTGCTAAACGATGTGTTTTTTGCAAAAAGTTTTTATACAAAAGTTGCTTAAAAAATCAAATTAATCCATTTTTGAAAAAAAA[A/T]
AGCTAATACTTAATTAATCATGCAATAATGCGTGCTCCGTTTTGCGTGCCAGGGAGGAGGGGTTCTCCCGAACGCAGCTGGCAGGGTTGTAACTGCAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.10% | 30.80% | 17.14% | 18.94% | NA |
| All Indica | 2759 | 39.50% | 4.20% | 25.05% | 31.21% | NA |
| All Japonica | 1512 | 12.10% | 86.30% | 0.73% | 0.86% | NA |
| Aus | 269 | 97.00% | 0.70% | 1.49% | 0.74% | NA |
| Indica I | 595 | 58.30% | 1.80% | 30.42% | 9.41% | NA |
| Indica II | 465 | 21.70% | 8.40% | 23.66% | 46.24% | NA |
| Indica III | 913 | 34.60% | 1.40% | 25.30% | 38.66% | NA |
| Indica Intermediate | 786 | 41.50% | 6.90% | 21.50% | 30.15% | NA |
| Temperate Japonica | 767 | 12.00% | 86.70% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 14.70% | 84.90% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 7.10% | 88.00% | 4.56% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 1.00% | 88.54% | 6.25% | NA |
| Intermediate | 90 | 30.00% | 34.40% | 21.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722814740 | T -> DEL | N | N | silent_mutation | Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0722814740 | T -> A | LOC_Os07g38050.1 | upstream_gene_variant ; 654.0bp to feature; MODIFIER | silent_mutation | Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0722814740 | T -> A | LOC_Os07g38040.1 | downstream_gene_variant ; 2759.0bp to feature; MODIFIER | silent_mutation | Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0722814740 | T -> A | LOC_Os07g38060.1 | downstream_gene_variant ; 2438.0bp to feature; MODIFIER | silent_mutation | Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0722814740 | T -> A | LOC_Os07g38040-LOC_Os07g38050 | intergenic_region ; MODIFIER | silent_mutation | Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722814740 | NA | 4.83E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 3.45E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 5.65E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 4.48E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 4.88E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 8.08E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 1.70E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 7.08E-07 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 8.93E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 7.21E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 3.40E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 9.02E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 2.27E-12 | mr1986 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722814740 | NA | 1.24E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |