\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722814740:

Variant ID: vg0722814740 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22814740
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, A: 0.44, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGCAGTTACAACCCTGCCAGCTGCGTTCGGGAGAACCCCTCCTCCCTGGCACGCAAAACGGAGCACGCATTATTGCATGATTAATTAAGTATTAGCT[T/A]
TTTTTTTTCAAAAATGGATTAATTTGATTTTTTAAGCAACTTTTGTATAAAAACTTTTTGCAAAAAACACATCGTTTAGCAGTTTGAAAAGCGTGCGCGC

Reverse complement sequence

GCGCGCACGCTTTTCAAACTGCTAAACGATGTGTTTTTTGCAAAAAGTTTTTATACAAAAGTTGCTTAAAAAATCAAATTAATCCATTTTTGAAAAAAAA[A/T]
AGCTAATACTTAATTAATCATGCAATAATGCGTGCTCCGTTTTGCGTGCCAGGGAGGAGGGGTTCTCCCGAACGCAGCTGGCAGGGTTGTAACTGCAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 30.80% 17.14% 18.94% NA
All Indica  2759 39.50% 4.20% 25.05% 31.21% NA
All Japonica  1512 12.10% 86.30% 0.73% 0.86% NA
Aus  269 97.00% 0.70% 1.49% 0.74% NA
Indica I  595 58.30% 1.80% 30.42% 9.41% NA
Indica II  465 21.70% 8.40% 23.66% 46.24% NA
Indica III  913 34.60% 1.40% 25.30% 38.66% NA
Indica Intermediate  786 41.50% 6.90% 21.50% 30.15% NA
Temperate Japonica  767 12.00% 86.70% 0.00% 1.30% NA
Tropical Japonica  504 14.70% 84.90% 0.00% 0.40% NA
Japonica Intermediate  241 7.10% 88.00% 4.56% 0.41% NA
VI/Aromatic  96 4.20% 1.00% 88.54% 6.25% NA
Intermediate  90 30.00% 34.40% 21.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722814740 T -> DEL N N silent_mutation Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0722814740 T -> A LOC_Os07g38050.1 upstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0722814740 T -> A LOC_Os07g38040.1 downstream_gene_variant ; 2759.0bp to feature; MODIFIER silent_mutation Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0722814740 T -> A LOC_Os07g38060.1 downstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0722814740 T -> A LOC_Os07g38040-LOC_Os07g38050 intergenic_region ; MODIFIER silent_mutation Average:67.027; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722814740 NA 4.83E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 3.45E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 5.65E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 4.48E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 4.88E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 8.08E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 1.70E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 7.08E-07 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 8.93E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 7.21E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 3.40E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 9.02E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 2.27E-12 mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722814740 NA 1.24E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251